e-ISSN 2147-8325
Turkish Journal of Immunology Türk İmmünoloji Dergisi
VOLUME / Cilt 5 NUMBER/ Sayı 1 APRIL / Nisan 2017
1974 TÜRK İMMÜNOLOJİ DERNEĞİ
The Official Journal of the Turkish Society of Immunology Türk İmmünoloji Derneği’nin Resmi Yayın Organıdır
www.turkishimmunology.org
Turkish Journal of Immunology Türk İmmünoloji Dergisi Volume/Cilt 5 Turkish Journal of Immunology is the official and periodical journal of the Turkish Society of Immunology. It is published three times a year in April, August and December. Türk İmmünoloji Dergisi Türk İmmünoloji Derneği’nin bilimsel içerikli resmi ve süreli yayın organıdır; Nisan, Ağustos ve Aralık aylarında olmak üzere yılda 3 sayı olarak yayımlanmaktadır. e-ISSN 2147-8325 Type of Publication / Yayın Türü Periodical / Yerel Süreli Funding / Finansman: Turkish Society of Immunology / Türk İmmünoloji Derneği Material published in the Journal is covered by copyright ©2016 Turkish Journal of Immunology. All rights reserved. Dergide yayımlanan malzemenin telif hakkı Türk İmmünoloji Dergisi’ne aittir. Copyright ©2016. Her hakkı saklıdır.
|
Number/Sayı 1
Owner on behalf of the Turkish Society of Immunology / Türk İmmünoloji Derneği adına Sahibi Günnur Deniz, PhD Editor-in-Chief / Editör Günnur Deniz, PhD Managing Editor / İdari Editör Akif Turna, M.D., PhD Associate Editors / Editör Yardımcıları H. Barbaros Oral, M.D., PhD Yıldız Camcıoğlu, M.D.
Turkish Journal of Immunology is indexed in Turkiye Citation Index and EBSCO Türk İmmünoloji Dergisi Türkiye Atıf Dizini ve EBSCO veri tabanlarında yer almaktadır.
1974
TÜRK İMMÜNOLOJİ DERNEĞİ
Publishing Manager / Sorumlu Yazı İşleri Müdürü Günnur Deniz Board of Directors / Yönetim Kurulu President / Başkan Günnur Deniz Vice President / Başkan Yardımcısı Güher Saruhan Direskeneli
Executive office / Yönetim yeri ve adresi: Yıldız Cad. No:55/ 1-2, 34353 Beşiktaş, İstanbul, Turkey Tel: +90 212 414 2097 URL: www.turkimmunoloji.org.tr İletişim / Editorial Contact Person: Günnur Deniz, PhD e-mail:
[email protected] Publisher / Yayın Hizmetleri
Secretary / Genel Sekreter Ayça Sayı Yazgan Treasurer / Veznedar Arzu Aral Members / Üyeler Barbaros Oral İhsan Gürsel Tolga Sütlü
BAYT Bilimsel Araştırmalar Basın Yayın ve Tanıtım Ltd. Şti. Ziya Gökalp Cad., 30/31, Kızılay, 06420 Ankara Tel. +90 312 431 3062, Fax: +90 312 431 3602 e-mail:
[email protected] www.bayt.com.tr
|
April/Nisan 2017 Reviewers / Danışma Kurulu Ahmet Özen, M.D., Turkey Ayça Sayı Yazgan, M.D., Turkey Ayten Nalbant, M.D., Turkey Barbaros Oral, M.D., Turkey Batu Erman, M.D., Turkey Ceren Çıracı, M.D, Turkey Cevayir Çoban, M.D., Japan Cezmi Akdiş, M.D., Switzerland Dicle Güç, M.D., Turkey Dolores Jaraquemada, M.D., Spain Elif Karakoç Aydıner, M.D., Turkey Esin Aktaş Çetin, M.D., Turkey Fatih Kocabaş, M.D., Turkey Ferah Budak, M.D., Turkey Gaye Erten, M.D., Turkey Gülderen Yanıkkaya Demirel, M.D., Turkey Güneş Esendağlı, M.D., Turkey Güngör Sobacı, M.D., Turkey Günnur Deniz, M.D., Turkey Haner Direskeneli, M.D., Turkey Hasibe Artaç M.D., Turkey İhsan Gürel, M.D., Turkey İlgin Özden, M.D., Turkey İsmail Reisli, M.D., Turkey Mayda Gürsel, M.D., Turkey Moshe Ariditi, M.D., USA Mustafa Diken, M.D., Germany Nerin Bahçeciler, M.D., Republic of Northern Cyprus Neslihan Cabioğlu, M.D., Turkey Nesrin Özeren, M.D., Turkey Ning Du, M.D., USA Onur Boyman, M.D., İsviçre Oral Alpan, M.D., USA Prabhat Kumar Sharma, M.D., India Ravi Kalathur, M.D., USA Sandeep Kumar, M.D., India Senthilkumar Palaniyandi, M.D., USA Stephen E. Christmas, M.D., UK Suzan Adın Çınar, M.D., Turkey Şefik Şanal Alkan, M.D., Switzerland Tiraje Celkan, M.D., Turkey Tolga Sütlü, M.D., Turkey Tunç Akkoç, M.D., Turkey Vedat Bulut, M.D., Turkey
The control of conformity with the journal standards and the typesetting of the articles in this journal, the control of the English/Turkish abstracts and references and the preparation of the journal for publishing were performed by BAYT Publishing. Bu dergideki yazıların dergi standartlarına uygunluğunun kontrolü, dizimi, İngilizce/Türkçe özetlerin ve kaynakların denetimi, derginin yayına hazırlanması BAYT tarafından gerçekleştirilmiştir.
Turkish Journal of Immunology Türk İmmünoloji Dergisi Volume/Cilt 5
|
Number/Sayı 1
|
April/Nisan 2017
CONTENTS / İÇİNDEKİLER
ii Instructions for Authors
vi Yazarlara bilgi
xii From the Editor / Editörden
ORIGINAL ARTICLE / ÖZGÜN MAKALE 1 Mast Cells in Leprosy Patients with Reversal Reactions Tip 1 Reaksiyon Pozitif Lepra Hastalarında Mast Hücreleri Renni Yuniati, Fatihatul FM, Fika A, Prasetyowati S, Indropo A
5 The Increase in LEAP-2 mRNA Suggests a Synergistic Probiotics-Doxycycline Interaction in Chickens
LEAP-2 mRNA’sındaki Yükselme, Piliçlerde Probiotikler ile Doksisiklin Arasındaki Sinerjik İlişkiyi İşaret Etmektedir Ivelina Pavlova, Aneliya Milanova
13 Immunomodulatory Effect of Propolis Extract on Granzyme Expression in CD8+ and CD4+CD25+ T Cells
Propolis Ekstresinin CD8+ ve CD4+CD25+ T Hücrelerindeki Granzim İfadesi Üzerine Olan Bağışıklık Düzenleyici Etkileri Zauhani Kusnul, Pudji Rahayu, Muhaimin Rifai, Edi Widjajanto
20 Molecular characterization of Amandin, an Allergen from Almond (Prunus dulcis) and the Effect of Heat and Enzymatic Treatments on Human IgE and Rabbit IgG Sensitivity to Almond Allergens
Bademde (Prunus dulcis) Bulunan Bir Allerjen Olan Amandin’in Moleküler Olarak Tanımlanması ve
Enzim Uygulaması ve Isının Badem Hassasiyeti ile Oluşan İnsan IgE’si ve Tavşan IgG’sine Olan Etkisi Ibtissam Ouahidi, Chahid Ouaazizi, Najlae Mejrhit, Ouarda Azdad, Lotfi Aarab
31 ERRATUM/ Düzeltme
i
INSTRUCTIONS FOR AUTHORS Turkish Journal of Immunology (Türk immünoloji Dergisi) (e-ISSN 2147-8325) accepts original articles, case reports, short communications, invited reviews and editorial papers, on condition that they have not been published elsewhere previously but in abstract form. The editors will consider for publication all suitable papers dealing directly or indirectly with immunology. The editors also encourage submission of book reviews, reports of meetings and correspondences on subjects within the scope of immunology. The official languages of the journal are Turkish and English. Turkish Journal of Immunology is the official and periodical journal of the Turkish Society of Immunology. It is published three times a year in April, August and December. All papers are subject to editorial revision for purpose of conformity to the style adopted by the journal. All rights of reproduction are reserved in respect of all papers published in this journal.
SUBMISSION OF MANUSCRIPTS
All manuscripts must be submitted via the online submission system after logging on to the website www.turkimmunoloji.dergisi.org. Authors who have any queries can contact the following addresses: Prof. Dr. Günnur Deniz Editor in Chief İstanbul Üniversitesi, DETAE, İmmünoloji Anabilim Dalı, Vakıf Gureba Cad., 34393 Şehremini, İstanbul, Türkiye E-mail:
[email protected] Tel: 0212 - 414 20 97 Fax: 0212 - 532 41 71 Assoc. Prof. Dr. Akif Turna Managing Editor İstanbul Üniversitesi Cerrahpaşa Tıp Fakültesi Göğüs Cerrahisi Anabilim Dalı, 34098 Fatih, İstanbul, Türkiye E-mail:
[email protected] Tel: 0212 - 414 3327 Fax: 0212 - 632 8474
ONLINE SUBMISSIONS
Only online submissions are accepted for quick peer-review and to prevent delay in publication. Manuscripts can be submitted online at www. turkimmunoloji.dergisi.org. The online system consists of four main parts: manuscript submission module (MSM), editorial module, admin module and referee module. The editorial module, admin module and referee module work on the background and will not be open to the enduser. The term module used in this document refers only to the MSM. As part of the peer-review system, authors will also receive the referee reports and can observe the current status of their manuscript(s) online. An online help is also available during the submission process. Supported formats, Supported fonts, Supported images Supported formats
Supported fonts
Supported images
.doc or .docx (MS Office for Windows or Macintosh)
Arial Times Times New Roman
.jpeg .tif
The module accepts the body of the manuscript as a whole document; thus, documents should be completed as a .doc or .docx file before submission. The supported file extensions, fonts and other formats are given in Table. All corresponding authors should be provided a password and an username after providing the information needed. After logging on the article submission system with your own password and username, please read carefully the directions of the system to provide all needed information in order not to delay the processing of the manuscript. Attach the manuscript, all Figures, Tables and additional documents.
ii
Please also attach the coverletter with “Assignment of Copyright and Financial Disclosure” forms, check-list of below mentioned guidelines according to the type of the manuscript. All pages are supported with help menus; if you require additional help or experience a problem, please send an email to
[email protected].
EDITORIAL POLICIES
All manuscripts will be evaluated by the scientific board for their scientific contribution, originality and content. Authors are responsible for the accuracy of the data. The journal retains the right to make appropriate changes on the grammar and language of the manuscript. When suitable the manuscript will be send to the corresponding author for revision. The manuscript, when published, will become the property of the journal and copyright will be taken out in the name of the journal. Articles previously published in any language will not be considered for publication in the journal. Authors cannot submit the manuscript for publication in another journal. All changes in the manuscript will be made after obtaining written permission of the author and the publisher. Full text of all articles can be downloaded at the website of the journal www.turkishimmunology.org
PREPARATION OF MANUSCRIPTS
The “Journal of Immunology” follows the “Uniform Requirements for Manuscripts Submitted to Biomedical Journals” (International Committee of Medical Journal Editors: Br Med J 1988;296: 401-5). Upon submission of the manuscript, authors are to indicate the type of trial/research and provide the checklist of the following guidelines when appropriate: Consort statement for randomized controlled trials (Moher D, Schultz KF, Altman D, for the CONSORT Group. The CONSORT statement revised recommendations for improving the quality of reports of parallel group randomized trials. JAMA 2001;285:1987-91), the QUOROM statement for meta-analysis and systemic reviews of randomized controlled trials (Moher D, Cook DJ, Eastwood S, Olkin I, Rennie D, Stroup DF. Improving the quality of reports of meta-analyses of randomized controlled trials: the QUOROM statement. Quality of Reporting of Meta-Analyses. Lancet 1999: 354: 1896-900) and the MOOSE guidelines for metaanalysis and systemic reviews of observational studies (Stroup DF, Berlin JA, Morton SC, et al. Metaanalysis of observational studies in epidemiology: a proposal for reporting Meta-analysis of observational Studies in Epidemiology (MOOSE) group. JAMA 2000;283:2008-12).
HUMAN AND ANIMAL STUDIES
Manuscripts submitted for publication must contain a statement to the effect that all human studies have been reviewed by the appropriate ethics committee and have therefore been performed in accordance with the ethical standards laid down in an appropriate version of the 1975 Declaration of Helsinki. It should also be stated clearly in the text that all persons gave their informed consent prior to their inclusion in the study. Details that might disclose the identity of the subjects under study should be omitted. Reports of animal experiments must state that the “Principles of Laboratory Animal Care” (NIH publication No. 86-23, revised 1985) were followed, as well as specific national laws where applicable. The editors reserve the right to reject manuscripts that do not comply with the above mentioned requirements. The author will be held responsible for false statements or for failure to fulfill the above mentioned requirements. In a cover letter the authors should state if any of the material in the manuscript is submitted or planned for publication elsewhere in any form including electronic media. The cover letter must contain address, telephone, fax and the e-mail address of the corresponding author.
CONFLICT OF INTEREST
Authors must indicate whether or not they have a financial relationship with the organization that sponsored the research. They should also
Turk J Immunol state that they have had full control of all primary data and that they agree to allow the Journal to review their data if requested. Therefore manuscripts should be accompanied by the “Conflict of Interest Disclosure Form.” The form can be obtained from the journal webpage (www.turkimmunoloji.dergisi.org).
COPYRIGHT
The author(s) transfer(s) the copyright to his/their article to the Turkish Journal of Immunology effective if and when the article is accepted for publication. The copyright covers the exclusive and unlimited rights to reproduce and distribute the article in any form of reproduction (printing, electronic media or any other form); it also covers translation rights for all languages and countries. For U.S. authors the copyright is transferred to the extent transferable. Manuscripts must be accompanied by the “Copyright Transfer Statement”.
MANUSCRIPT SPECIFICATIONS The manuscript, figures and tables, prepared under “Microsoft Office Word Program”, 1.5 spaced on one side of A4 sized page, with margins of at least 25 mm should be submitted. Original articles should not exceed 15 pages including the tables and figures. Brief reports should not exceed 5 pages including one figure and/or maximum two tables. Title Page The first page should include (i) the title of the article in a concise but informative style, (ii) first name, middle initial and last name of each author, (iii) name of department(s) and institution(s) to which the work should be attributed, (iv) name, address, telephone and fax numbers and e-mail address of the corresponding author, (v) name and address of the author to whom requests for reprints should be addressed, (vi) source(s) of support in the form of grants, equipments, drugs, etc.,(vii) a short running title of no more than 40 characters. Abstract All manuscripts should be accompanied by a structured abstract. Word limitation is 250 words for original articles and 100 words for brief reports and case reports. The abstract should state the purpose of the study or investigation, basic procedures, methods, main findings, specific data, statistical significance and the principal conclusions. Key Words Three to six key words should be added at the end of the summary. The key words that will be added should be checked at Turkish Science Terms (www.bilimterimleri.com) and listed alphabetically. Do not use abbreviations as key words. The text of an original article should be divided into sections of Introduction, Materials and Methods, Results and Discussion. Other types of articles such as case reports, reviews and perspectives will be published according to standard formats. Introduction State concisely the purpose and rationale for the study and cite only the most pertinent references as background. Materials and Methods Describe your selection of the observational or experimental subjects clearly. Identify the methods and procedures in sufficient detail to allow other investigators to reproduce the results. Give references to established methods, including statistical methods, brief modified methods, give reasons for using them and evaluate their limitations. Identify all drugs and chemicals used, including generic name(s), dose(s) and route(s) of administration. Describe statistical methods in enough detail to provide a knowledgeable reader without access to the original data to evaluate the reported results. Give details about randomization, describe treatment complications, give number of observations, specify any computer program used. When reporting experiments on human subjects indicate whether the procedures followed were in accordance
with the ethical standarts of the responsible committee on human experimentation. Do not use patient’s name, initials, or registration numbers especially, on any illustrative material. Results Present the detailed findings supported with statistical methods. Figures and tables should supplement, not duplicate the text; presentation of data in either one or the other will suffice. Emphasize only your important observations; do not compare your observations with those of others. Such comparisons and comments are reserved for the discussion section. Discussion State the importance and significance of your findings but do not repeat the details given in the Results section. Limit your opinions to those strictly indicated by the facts in your report. Compare your finding with those of others. No new data are to be presented in this section. Acknowledgements After the discussion section, one or more statements can be made to acknowledge (i) contributions which do not justify authorship, (ii) technical help, (iii) financial and material support, specifying the nature of the support. References If the surname of the first author of the referenced article is given, “et al.” should be added after it, followed by its reference number within square brackets “[ ]” (superscript preferred), and then the sentence should be completed. Give references in the text using Arabic numerals in brackets “[ ]” (superscript preferred). If different references are given for different statements, each reference should be given within square brackets “[ ]” after the punctuation mark at the end of the relevant statement. Number references consecutively in the order in which they are first mentioned in the text. List all authors and/or organizations. The titles of the journals should be abbreviated according to the style used in Index Medicus. Consult List of Journals Indexed in Index Medicus. Include among the references, papers accepted but not yet published, and those submitted only, too. Examples of References
1. Journal article: Yazıcı H, Akogan G, Yalcin B, Muftuoglu A. The high prevalence of HLA B5 in Behçet’s disease. Clin Exp Immunol 1977;30:259-61.
2. Journal article, in press: Gudelj L, Deniz G, Rukavina D, Johnson PM, Christmas SE. Expression of functional molecules by human CD3 decidual granular leucocyte clones. Immunology 1996. [in press]
3. Journal article submitted for publication: Akdeniz H, Ozdemirli M, Rodgers O, El-Khatib M, Shirahama T, Ju ST. Modified apoptosis [submitted for publication].
4. Complete book: Mazza J, editor. Manual of clinical hematology. 3rd ed. Boston: Little Brown and Company; 1988.
5. Chapter of book: Lunkens JN. Immune deficiency diseases: Inherited and acquired. In: Lee GR, L, Bithell TC, Foerster J, Athens JW, Lukens JN, editors. Wintrobe’s clinical hematology. 9th ed. Philadelphia: Lea and Febiger; 1993. p. 1676-703.
iii
Turk J Immunol 6. Abstract: Greco C, Gandolfo GM, Alvino S, Cianciulli AM, Venturo I, Lopez M, et al. Tumor-associated MGUS (monoclonal gammopathies of uncertain significance): differences in serum levels of IL-6 (interleukin-6) and other markers. Proc Am Soc Clin Oncol 1993;408:1397. [Abstract]
7. Correspondence: Ozsoylu S. Idiopathic thrombocytopenic purpura. Acta Haematol (Basel) 1994;92:55. [letter] Tables, Figures and Pictures Tables should be created in your original word-processing software or inserted in the original file from excel or another compatible software. Please ensure the table or figure created complies with the limitations mentioned in Table. Tables created as a picture file are problematic and are not advised. Figures should be embedded in the original file, but the system also requires that they be sent separately. The supported image files are given in table. Each figure must have an accompanying legend defining abbreviations or symbols found in the figure. Units of Measurement Measurements should be reported in the metric system in terms of the international System of Units (SI), Consult SI Unit Conversion Guide, New England Journal of Medicine Books 1992, when necessary. Abbreviations and Symbols Use standard abbreviations. Avoid abbreviations in the title and abstract. The full term for which an abbreviation stands should precede its first use in the text unless it is a standard abbreviation. Special characters not available on the keyboard can be accessed either from the insert menu (select symbol) or by selecting symbol as a font from the font window of the formatting toolbar. Please check these characters in your original file and proofs as the softwares tend to replace these characters with others if they are unreadable. Peer Review Manuscripts that have passed an initial screening by the Editors are reviewed by members of the Editorial Board and/or other experts in the field. The Editors select the reviewers and make the final decision on the manuscript. Referees who review a manuscript remain unknown to the authors. Every manuscript is treated by the Editors and reviewers as privileged information, and they are instructed to exclude themselves from review of any manuscript that may involve a conflict of interest or the appearance of such.
iv
REVISED MANUSCRIPTS
Following initial peer-review, articles judged worthy of further consideration often require revisions. Revised manuscript generally must be received within 2 months of the date on the initial decision. Extensions must be requested from the Associate Editor at least two weeks before the 2-month revision deadline expires. Otherwise Turkish Journal of Immunology will reject manuscripts which are not received within 2-months of the date on the initial revision decision. All reviewers’ comments should be addressed and revisions made should be started with page and line of the text. Authors are responsible for the truth of presented data and references. The Editors have the right to withdraw or retract the paper from the scientific literature in case of proven allegations of misconduct. A Copyright Transfer and Conflict of Interest form, signed by all authors, must also be submitted by fax to +90 224 2954149 or by e-mail (after scanning). Both forms can be found at the website www. turkimmunoloji.dergisi.org. Proofreading Authors of accepted manuscripts will receive electronic page proofs directly from the printer and are responsible for proofreading and checking the entire article, including tables, figures, and references. Page proofs must be returned within 48 hours to avoid delays in publication. English-Language Editing All manuscripts are professionally edited by English language editor before publication. Online Early Turkish Journal of Immunology publish abstracts of accepted articles online in advance of their publication in a printed issue. Society and Journal Websites www.turkimmunoloji.org.tr (Turkish Society of Immunology) www.turkishimmunology.org (Turkish Journal of Immunology) Ø Citation of published manuscripts in Turkish Journal of Immunology should be as follows: Akkoc T, Arikan C, Ozdemir C, Bahceciler NN, Barlan IB. Mycobacterium vaccae immunization to pregnant Balb/C mice downregulated IL-5 cytokine levels in splenocyte cultures of offsprings, Turk J Immunol 2002;7:25-8. Ø The Journal name should be abbreviated as “Turk J Immunol” © All rights of the articles published in Turk J Immunol are reserved by the Turkish Society of Immunology.
Acknowledgement of Authorship, Exclusive Publication Statement, Conflict of Interest Statement, and Transfer of Copyright Agreement Authorship
Conflict of Interest
All persons designated as authors should qualify for authorship. Each author should have participated sufficiently in the work to take public responsibility for the content.
Conflict of interest for a given manuscript exists when a participant in the peer review and publication process-author, reviewer, and editor-has ties to activities that could inappropriately influence his or her judgment, whether or not judgment is in fact affected. Financial relationships with industry (for example, through employment, consultancies, stock ownership, honoraria, expert testimony), either directly or through immediate family, are usually considered to be the most important conflicts of interest. However, conflicts can occur for other reasons, such as personal relationships, academic competition, and intellectual passion.
Authorship credit should be based only on substantial contributions to 1) conception and design, or analysis and interpretation of data; and to 2) drafting the article or revising it critically for important intellectual content; and on 3) final approval of the version to be published. Conditions 1, 2, and 3 must all be met. Participation solely in the acquisition of funding or the collection of data does not justify authorship. General supervision of the research group is not sufficient for authorship. Any part of an article critical to its main conclusions must be the responsibility of at least one author. Editors may ask authors to describe what each contributed; this information may be published. Increasingly, multicenter trials are attributed to a corporate author. All members of the group who are named as authors, either in the authorship position below the title or in a footnote, should fully meet the above criteria for authorship. Group members who do not meet these criteria should be listed, with their permission, in the Acknowledgments or in an appendix. The order of authorship should be a joint decision of the coauthors. Because the order is assigned in different ways, its meaning cannot be inferred accurately unless it is stated by the authors. Authors may wish to explain the order of authorship in a footnote.
Public trust in the peer review process and the credibility of published articles depend in part on how well conflict of interest is handled during writing, peer review, and editorial decision making. Bias can often be identified and eliminated by careful attention to the scientific methods and conclusions of the work. Financial relationships and their effects are less easily detected than other conflicts of interest. Participants in peer review and publication should disclose their conflicting interests, and the information should be made available so that others can judge their effects for themselves. Because readers may be less able to detect bias in review articles and editorials than in reports of original research, some journals do not accept reviews and editorials from authors with a conflict of interest. When they submit a manuscript, whether an article or a letter, authors are responsible for recognizing and disclosing financial and other conflicts of interest that might bias their work. They should acknowledge in the manuscript all financial support for the work and other financial or personal connections to the work. (*Reference: Uniform requirements for manuscripts submitted to biomedical journals. Ann Intern Med 1997;126:36-47)
THIS FIELD MUST BE FILLED OUT AND ANSWERED COMPLETELY Author(s) should clearly state below whether or not there are any conflicts of interest regarding the submission and publication of the manuscript and its potential implications
All authors of the manuscript titled: certify that they qualify for authorship because of substantial contribution to the work submitted. The authors undersigned declare that this manuscript has not been published nor is under simultaneous consideration for publication elsewhere. The authors agree to transfer the copyright to the Turkish Journal of Immunology to be effective if and when the manuscript is accepted for publication and that the manuscript will not be published elsewhere in any other language without the consent of the Turkish Journal of Immunology. The final form of the manuscript has been seen and approved by all authors. Authors, Name, Surname
Contribution
Date
Signature
1. .........................................................................................................
..........................................................................................
.............................................
.......................................................................
2. .........................................................................................................
..........................................................................................
.............................................
.......................................................................
3. .........................................................................................................
..........................................................................................
.............................................
.......................................................................
4. .........................................................................................................
..........................................................................................
.............................................
.......................................................................
5. .........................................................................................................
..........................................................................................
.............................................
.......................................................................
6. .........................................................................................................
..........................................................................................
.............................................
.......................................................................
7. .........................................................................................................
..........................................................................................
.............................................
.......................................................................
8. .........................................................................................................
..........................................................................................
.............................................
.......................................................................
Correspondent author:
Institution phone:
GSM:
e-mail:
................................................................................................................
..........................................................................................
.............................................
@ .......................................................................
Fax:
v
YAZARLARA BİLGİ Türk İmmünoloji Dergisi (e-ISSN 2147-8325), başka bir yerde özet haricinde yayımlanmamış olması koşuluyla, özgün makale, olgu sunumu, kısa bildiri, derleme ve editör yazılarını kabul etmektedir. Editörler, immünoloji ile doğrudan ya da dolaylı olarak ilintili tüm makaleleri yayına hazırlar. Ayrıca editörler immünoloji alanı ile ilgili kitap tanıtımları, toplantı raporları ve yazışmaların gönderilmesini de teşvik eder. Derginin resmi dili Türkçe ve ingilizcedir. Türk immünoloji Dergisi Türk İmmünoloji Derneği’nin bilimsel içerikli resmi ve süreli yayın organıdır; Nisan, Ağustos ve Aralık aylarında olmak üzere yılda 3 sayı olarak yayımlanmaktadır. Makalelerin tümü, derginin benimsediği üsluba uygunluk açısından editörün incelemesinden geçer. Bu dergide yayımlanan makalelerin tümünün çoğaltım hakkı saklıdır.
MAKALE GÖNDERİMİ
Makalelerin tümü, www.turkimmunoloji.dergisi.org sitesine giriş yapılarak online gönderim sistemi üzerinden iletilecektir. Ayrıntılı bilgi almak isteyen yazarlar, aşağıda irtibat bilgileri verilen yetkili kişilere ulaşabilir: Prof. Dr. Günnur Deniz Editor in Chief İstanbul Üniversitesi, DETAE, immünoloji Anabilim Dalı, Vakıf Gureba Cad., 34393 Şehremini, İstanbul, Türkiye E-mail:
[email protected] Tel: 0212 - 414 20 97 Faks: 0212 - 532 41 71 Assoc. Prof. Dr. Akif Turna Managing Editor İstanbul Üniversitesi Cerrahpaşa Tıp Fakültesi Göğüs Cerrahisi Anabilim Dalı, 34098 Fatih, İstanbul, Türkiye E-mail:
[email protected] Tel: 0212 - 414 3327 Faks: 0212 - 632 8474
ONLİNE GÖNDERİM
Kısa süreli hakem denetimi ve yayını geciktirmemek için yalnızca online gönderimler kabul edilmektedir. Makaleler www.turkimmunoloji. dergisi.org adresinden online olarak gönderilmelidir. Online sistem dört ana kısımdan oluşmaktadır: (i) makale gönderim modülü (MSM), (ii) editör modülü, admin modülü ve hakem modülü. Editör modülü, (iii) admin modülü ve (iv) hakem modülü arka planda çalışır ve son kullanıcı ekranına yansımaz. Bu dökümanda kullanılan terim modülü, yalnızca MSM içindir. Hakem denetimli sistemin bir parçası olarak, yazarlara da hakem raporu iletilecek olup, makalelerinin durumunu online olarak takip edebileceklerdir. Makale gönderim sürecinde yazarlara online yardım desteği de verilecektir. Desteklenen formatlar, Desteklenen fontlar ve Desteklenen görüntüler Desteklenen formatlar
Desteklenen fontlar
Desteklenen görüntüler
.doc or .docx (MS Office veya Windows için Macintosh)
Arial Times Times New Roman
.jpeg .tif
Modül makaleyi tek bir doküman olarak kabul ettiği için, dokümanlar gönderilmeden önce .doc veya .docx uzantılı olmalıdır. Desteklenen dosya uzantıları, fontlar ve diğer formatlar Tablo’da verilmiştir. Makale gönderen yazarların tümüne gerekli bilgiler verildikten sonra bir kullanıcı adı ve şifre iletilecektir. Bu kullanıcı adı ve şifre ile makale gönderim sistemine giriş yapan yazarların, yayın sürecini geciktirmemesi için sistemde yer alan talimatları dikkatlice okumaları gerekmektedir. Yazarların makaleleri tüm şekiller, tablolar ve ilave dokümanlar ile birlikte göndermesi rica olunur. Bununla birlikte, yazarların Telif Hakkı
vi
Devri ve Mali İfşa Formu ve makalenin türüne göre kılavuzda belirtilen kontrol listesi ile birlikte bir kapak yazısı iletmesi de gerekmektedir. Sayfalar, yardım menüsü ile desteklenmektedir. Yardım almak veya yaşadığı bir sorunu paylaşmak isteyen yazarlar,
[email protected] adresine e-posta gönderebilir.
EDİTÖR POLİTİKASI
Makaleler bilimsel katkı, özgünlük ve içerik açısından bilimsel kurul tarafından değerlendirilir. Yazarlar, makalelerinde verdikleri bilgilerin doğruluğundan sorumludur. Dergi, makalenin dilbilgisi ve dilinde birtakım değişiklikler yapma hakkını saklı tutar. Uygun olduğu durumlarda, makale revizyon için yazara gönderilir. Yayımlanan makale, derginin mülkü olur ve telif hakkı dergi adına satın alınır. Daha önce başka bir dilde yayımlanmış makaleler, dergiye kabul edilemez. Yazarlar, immünoloji dergisine gönderdikleri ve telif hakkını devrettikleri makaleyi bir başka dergiye gönderemez. Yazar ve yayıncıdan yazılı izin alındıktan sonra, makale üzerinde değişiklik yapılabilir. Makalelerin tam metni, www.turkishimmunology.org adresinden elektronik formatta indirilebilir.
MAKALELERİN HAZIRLANMASI
immünoloji Dergisi, “Biyomedikal Dergilere Gönderilen Makalelerde Bulunması Gerekli Standartlar”a (Uluslararası Tıbbi Dergi Editörleri Kurulu: Br Med J 1988;296:401-5) uygun olarak hazırlan m aktadır. Makale gönderimini takiben, yazarlar çalışma/araştırmanın türünü ve aşağıdaki kılavuzda belirtilen kontrol listesini temin etmek durumundadır: randomize kontrollü çalışmalar için CONSORT kılavuzu (CONSORT grubu üyeleri: Moher D, Schultz KF, Altman D. “The CONSORT statement revised recommendations for improving the quality of reports of parallel group randomized trials”. JAMA 2001;285:1987-91JAMA 2001;285:1987-91); randomize kontrollü çalışmaların meta-analizi ve sistemik incelemesi için QUOROM kılavuzu (Moher D, Cook DJ, Eastwood S, Olkin I, Rennie D, Stroup DF. Randomize kontrollü çalışmaların meta-analizlerini raporlama kalitesinin iyileştirilmesi: QUOROM kılavuzu. “Quality of Reporting of Meta-Analyses”. Lancet 1999:354:1896-900) ve gözlemsel çalışmaların meta-analizi ve sistemik incelemesi için MOOSE kılavuzu (Stroup DF, Berlin JA, Morton SC ve ark. “Metaanalysis of observational studies in epidemiology: a proposal for reporting Metaanalysis of observational Studies in Epidemiology (MOOSE) group”. JAMA 2000;283:2008-12).
İNSAN VE HAYVAN ÇALIŞMALARI
Yayımlanması için gönderilen makalelerde, tüm insan çalışmalarının uygun etik kurullar tarafından incelendiğine ve bu nedenle 1975 Helsinki Bildirgesi etik standartlarına uygun olduğuna ilişkin bir ifade yer almalıdır. Ayrıca çalışmaya dahil edilmeden önce hastaların tümüne bilgilendirilmiş onam formu verilmiş olduğuna ilişkin bilgi de açıkça yer almalıdır. Hastaların kimliğini ifşa edecek ayrıntı bilgilere yer verilemez. Hayvan deneyleri, “Laboratuvar Hayvanlarının Bakımı ve Kullanım ilkesi” (NIH yayın No. 86-23, revizyon tarihi: 1985) ve ulusal yönetmelikler uyarınca yürütülmelidir. Editörler, yukarıda sözü geçen gerekliliklere uygun olmayan makaleleri reddetme hakkını saklı tutar. Yanlış beyanlardan veya gerekliliklerin yerine getirilmemesinden yazarlar sorumlu tutulacaktır. Kapak yazısında yazarlar, makalenin bir bölümünün elektronik ortam dahil başka bir yerde yayımlandığı veya yayımlanmasının planlandığını belirtmekle yükümlüdür. Kapak yazısında yazışma yapacak yazarın adresi, mobil ve kurum telefon numarası ile faks numarası ve e-posta adresi mutlaka yer almalıdır. Ayrıca diğer yazarların mobil telefon numaraları da eklenmelidir.
ÇIKAR ÇATIŞMASI
Yazarlar araştırmaya sponsorluk yapan organizasyon ile mali ilişkisi olup olmadığını belirtmek durumundadır. Ayrıca yazarlar birincil verilerin
Turk J Immunol kontrolünü eksiksiz yaptığını ve gerektiğinde bu verilerin Dergi tarafından gözden geçirilmesinde mutabık olduğunu belirtmelidir. Bu nedenle, makalelere “Çıkar Çatışması ifşa Formu” da iliştirilmelidir. Bu forma, web sitesinden ulaşılabilir (www.turkimmunoloji.dergisi.org).
TELİF HAKKI
Yazarlar, makalenin yayına kabul edilmesi ve yayımlanması halinde, makalelerinin telif hakkını Türk İmmünoloji Dergisi’ne devreder. Telif hakkı, makalenin her türlü münhasır ve sınırsız olarak çoğaltım ve dağıtım hakkını (basılı, elektronik ortamda veya başka şekillerde) ve tüm dil ve ülkelerde yapılacak olan çeviri haklarını içerir. Amerikalı yazarların telif hakkı, devredilebilir olduğu kadar dergiye aktarılır. Makalelere “Telif Hakkı Devir Beyanı” iliştirilmelidir.
MAKALE ÖZELLİKLERİ
Makale, şekiller ve tablolar A4 sayfasında 1.5 satır aralığıyla yazılmış ve Microsoft Office Word Programı kullanılarak hazırlanmış olarak gönderilmelidir. Özgün makaleler, tablo ve şekiller dahil olmak üzere, 15 sayfayı geçmemelidir. Kısa sunumlar, bir şekil veya azami iki tablo dahil olmak üzere, 5 sayfayı geçmemelidir. Sayfası İlk sayfada (i) kısa ve bilgilendirici bir üslup ile makalenin başlığı; (ii) yazarların ilk, ikinci ve soyadları; (iii) çalıştıkları kurum ve bölümler; (iv) yazışma yapacak yazarın adı, adresi, telefon ve faks numarası ve e-posta adresi; (v) yeniden basım talebini değerlendirecek yazarın adı ve adresi; (vi) bağış, ekipman, ilaç vs. şekillerde verilen desteğin kaynakları ve (vii) 40 karakteri geçmeyen kısa başlık yer almalıdır. Özet Makalelerde yapılandırılmış özet yer almalıdır. Özgün makalelerin özetleri 250 kelimeyi; kısa sunum ve olgu sunumlarının özetleri 100 kelimeyi geçmemelidir. Özet bölümünde çalışmanın veya araştırmanın amacı, yapılan işlemler, kullanılan yöntemler, elde edilen ana bulgular, spesifik veriler, istatistiksel anlamlılık ve ana sonuçlar yer almalıdır. Türkçe ve İngilizce özetler, birbirleriyle örtüşecek şekilde yazılmalıdır. Anahtar Kelimeler Özetin sonuna 3 ila 6 Anahtar sözcük eklenmelidir. Eklenecek anahtar sözcükler Türkiye Bilim Terimleri (www.bilimterimleri.com)’nden kontrol edilmeli ve harf dizinine göre sıralanmalıdır. Anahtar kelime olarak kısaltma kullanılamaz. Özgün makale metni Giriş, Materyal ve Yöntem, Bulgular ve Tartışma olarak dört kısma ayrılır. Olgu sunumu, derleme ve perspektif gibi diğer makale türleri, standart formata uygun olarak yayımlanır. Giriş Makalenin amacı ve bilimsel zemini kısa ve öz olarak ifade edilme ve yalnızca en ilintili referanslara atıfta bulunulmalıdır. Materyal ve Yöntem Gözlemsel veya deneysel kişilerin seçim kriterleri açıkça tanımlanmalıdır. Kullanılan işlem ve yöntemler, başka araştırmacıların sonuçları tekrarlayabileceği şekilde ayrıntılarıyla anlatılmalıdır. İstatistiksel yöntemler dahil olmak üzere kullanılan birincil yöntemlere ve kısaca düzenlenmiş yöntemlere ilişkin referanslar verilmeli ve bu yöntemlerin seçilme nedenleri ve kısıtlılıkları değerlendirilmelidir. Jenerik isim, doz ve kullanım şekli dahil olmak üzere, kullanılan ilaç ve kimyasalların tümü belirtilmelidir. Orijinal verilere ulaşmadan anlaşılabilecek şekilde ayrıntılı olarak kullanılan istatistiksel yöntemler tanımlanmalı ve bildirilen sonuçlar değerlendirilmelidir. Randomizasyona ilişkin ayrıntılar, tedavi komplikasyonları, gözlem sayısı, kullanılan bilgisayar programları belirtilmelidir. İnsanlar üzerinde yapılan çalışmalar raporlanırken, uygulanan işlemleri insan deneyleri sorumlu kurulunun etik standartlarına uygun olduğu da belirtilmelidir. Hastaların adı, baş harfleri veya özellikle kayıt numaraları görsel materyaller üzerinde kullanılamaz.
Bulgular İstatistiksel yöntemler ile desteklenen ayrıntılı bulgular belirtilmelidir. Şekiller ve tablolar makaleyi destekler nitelikte olmalı, metnin tekrarı olmamalıdır. Yalnızca önemli gözlemlere yer verilmelidir. Gözlemler başka araştırmacıların gözlemleri ile karşılaştırılmamalıdır. Bu tür karşılaştırma ve yorumlara Tartışma bölümünde yer verilmelidir. Tartışma Çalışma bulgularının önemi ve anlamlı belirtilmeli; ancak Bulgular kısmında verilen ayrıntılar tekrarlanmamalıdır. Yazarın görüşleri, bilinen gerçekler ile sınırlandırılmalıdır. Bu bölümde çalışma bulguları, başka araştırmacıların bulguları ile karşılaştırılabilir. Ancak bu bölümde yeni veri sunulamaz. Teşekkür Tartışma kısmını takiben, bir veya iki cümleyle (i) yazar statüsünde olmayan, fakat çalışmaya katkıda bulunan, (ii) teknik destek sağlayan, (iii) mali ve materyal desteği verenlere, verdikleri desteğin niteliği belirtilerek teşekkür edilebilir. Referanslar Referansta bulunulan makalenin ilk yazarının soyadı verilmişse, ardından “ve ark.” ifadesi eklenmelidir. Takiben “[ ]” köşeli parantez içerisinde (tercihen üst imge olarak) referans numarası yazılmalıdır. Sonrasında cümle tamamlanabilir. Referanslar, “[ ]” köşeli parantez içerisinde (tercihen üst imge olarak) Arap rakamları ile yazılmalıdır. Farklı ifadeler için farklı referansların kullanılması halinde, her referans ilgili ifadenin sonundaki noktalama işaretinden sonra “[ ]” köşeli parantez içerisinde yazılmalıdır. Referanslar, metinde ilk geçtikleri yerden itibaren ardışık numarayla sıralanmalıdır. Tüm yazarların veya kurum ve kuruluşların adı yazılmalıdır. Dergi adları, Index Medicus’ta kullanılan üsluba göre kısaltılmalıdır. Indekslenen dergilerin listesi için bkz. Index Medicus. Referanslara kabul edilen ancak henüz yayımlanmayan ve yayımlanması için gönderilen makaleler de eklenebilir. Kaynak Örnekleri
1. Dergiden alınan makaleler: Yazıcı H, Akogan G, Yalcin B, Muftuoglu A. The high prevalence of HLA B5 in Behçet’s disease. Clin Exp Immunol 1977;30:259-61.
2. Dergiden alınan makaleler (baskıda): Gudelj L, Deniz G, Rukavina D, Johnson PM, Christmas SE. Expression of functional molecules by human CD3 decidual granular leucocyte clones. Immunology 1996. [in press]
3. Dergiye yayınlanması için gönderilen makaleler: Akdeniz H, Ozdemirli M, Rodgers O, El-Khatib M, Shirahama T, Ju ST. Modified apoptosis [submitted for publication].
4. Kitap: Mazza J, editor. Manual of clinical hematology. 3rd ed. Boston: Little Brown and Company; 1988.
5. Kitap bölümü: Lunkens JN. Immune deficiency diseases: Inherited and acquired. In: Lee GR, L, Bithell TC, Foerster J, Athens JW, Lukens JN, editors. Wintrobe’s clinical hematology. 9th ed. Philadelphia: Lea and Febiger; 1993. p. 1676-703.
6. Özet: Greco C, Gandolfo GM, Alvino S, Cianciulli AM, Venturo I, Lopez M, et al. Tumor-associated MGUS (monoclonal gammopathies of uncertain significance): differences in serum levels of IL-6 (interleukin-6) and other markers. Proc Am Soc Clin Oncol 1993;408:1397. [Abstract]
vii
Turk J Immunol 7. Yazışma: Ozsoylu S. Idiopathic thrombocytopenic purpura. Acta Haematol (Basel) 1994;92:55. [letter]
Tablolar, Şekiller ve Resimler Tablolar özgün kelime işleme yazılımı kullanılarak hazırlanmalı veya excel veya başka bir uyumlu yazılımdan alınarak özgün dosya içerisine yerleştirilmelidir. Tablo ve şekiller, Tablo’da belirtilen kısıtlılıklara uygun olarak hazırlanmalıdır. Resim dosyası olarak oluşturulan tablolar sorunlu olduğu için tavsiye edilmemektedir. Şekiller, özgün dosyaya gömülü olmalı; ancak istendiğinde ayrı olarak da gönderilebilmelidir. Desteklenen görüntü dosyaları Tablo’da belirtilmektedir. Şekillerde kısaltma ve sembolleri açıklayan notlar yer almalıdır.
Ölçü Birimleri Ölçü birimlerinde Uluslararası Birim Sistemi (SI) uyarınca metrik sistem kullanılmalıdır. Bkz. SI Dönüştürme Rehberi, New England Journal of Medicine Books, 1992.
Kısaltmalar ve Semboller Standart kısaltmalar kullanılmalıdır. Ancak başlık ve özet bölümlerinde kısaltma kullanılmaz. Standart bir kısaltma değil ise, metinde önce açılımı yazılmalıdır. Klavyede mevcut olmayan özel karakterlere, EKLE (simge ekle) menüsünden veya font penceresinden font olarak kopyalanarak ulaşılabilir. Bilgisayar yazılımları okunaklı olmayan karakterleri başka karakterlere dönüştürdüğünden, özgün dosyada ve son okuma dosyasında bu karakterler kontrol edilmelidir.
Hakem denetimi Editörler tarafından okunarak başlangıç taramasından geçen makaleler, Editör Kurulu veya alanın uzmanları tarafından gözden geçirilir. Editörler, inceleme yapacak kişileri seçer ve makaleye ilişkin nihai kararı verir. Yazarlara makaleyi inceleyecek olan hakemler hakkında bilgi verilmez. Makaleler Editörler ve hakemler tarafından özel bilgi olarak kabul edilir. Editörler ve hakemler, çıkar çatışmasına yol açabilecek makaleleri inceleyemez.
MAKALE REVİZYONU
İlk hakem denetiminin ardından, ileri değerlendirmeye alınacak makaleler genellikle revize edilir. Makaleler, ilk karar tarihinden itibaren iki ay içerisinde revize edilmelidir. Uzatma talebi, iki aylık süre
viii
bitmeden en az iki hafta önce Editör Yardımcısı’ndan talep edilmelidir. Aksi takdirde, Türk immünoloji Dergisi, ilk karar tarihinden itibaren iki ay içerisinde revize edilmeyen makaleleri reddedecektir. Hakemlerin yorumları yazarlara iletilmeli ve revizyonlar metnin sayfa ve sırasından başlatılmalıdır. Yazarlar, verilen veri ve referansların doğruluğundan sorumludur. Editörler, kanıtlanmış suistimal iddialarının olması halinde, makaleyi bilimsel literatürden geri çekme hakkını saklı tutar. Yazarlar tarafından imzalanan Telif Hakkı Devri ve Mali ifşa Formu, +90 224 2954149 nolu faks numarasına gönderilmeli veya tarandıktan sonra e-posta ile iletilmelidir. Her iki forma da, www. turkimmunoloji.dergisi.org adresinden ulaşılabilir. Son Okuma Makaleleri kabul edilen yazarlara, doğrudan yazıcıdan alınmış elektronik baskı gönderilir. Yazarlar tablo, şekil ve referanslar dahil olmak üzere makalenin tümünün son okumasının yapılmasından ve kontrolünden sorumludur. Yayını geciktirmemek için okunan sayfalar, 48 saat içerisinde dergiye iletilmelidir. İngilizce Dil Kontrolü Makaleler, yayımlanmadan önce İngilizce dil editörü tarafından redakte edilir. Ön Online Yayın Türk immünoloji Dergisi, makaleleri yeni sayıda yayımlamadan önce kabul edilen makalelerin özetlerini online olarak yayımlar. Derneğin ve Derginin Web Site Adresleri www.turkimmunoloji.org.tr (Türk İmmünoloji Derneği) www.turkishimmunology.org (Türk İmmünoloji Dergisi) Ø Türk immüoloji Dergisi’nde yayımlanmış makalelere atıfta bulunulurken, şu sıra izlenmelidir: Akkoc T, Arikan C, Ozdemir C, Bahceciler NN, Barlan IB. Mycobacterium vaccae immunization to pregnant Balb/C mice downregulated IL-5 cytokine levels in splenocyte cultures of offsprings, Turk J Immunol 2002;7:25-8. Ø Derginin adı, “Turk J Immunol” şeklinde kısaltılır. © Turk J Immunol’de yayımlanan makalelerin tüm hakkı, Türk immünoloji Derneği tarafından saklı tutulur.
Türk İmmünoloji Dergisi için Yazar Onay Formu Yazarlık Yazar olarak bildirilen kişilerin tümü yazarlık şartlarını yerine getirmelidir. Her bir yazarın, yazı içeriğinin sorumluluğunu üstlenecek derecede çalışmada görev almış olması gerekir. Yazarlık, yalnızca aşağıda belirtilen katkılardan elde edilecek bir haktır: 1) Düşünce ve tasarım ya da verilerin analizi ve yorumlanması, 2) makaleyi yazma ya da bilimsel içeriği açısından kapsamlı inceleme, 3) yayınlanmasına karar verilen makalenin son olarak gözden geçirilmesi ve onay verme. Her bir yazar, makalede yazar olarak adının geçebilmesi için bu üç koşulu yerine getirmelidir. Çalışma için mali destek arama ve bulma ya da verilerin toplanması gibi katkılar tek başına yazar olma hakkını doğurmaz. Ayrıca, çalışma yürütenlere genel olarak yapılan yardım ve rehberlikler de yazarlık için yeterli bir şart değildir. Çalışmanın sonuçları ve bütünlüğü ile ilgili olarak yazıda yer alan her bölüm, en az bir yazarın sorumluluğu altında olmalıdır. Makalelerde yazar sayısını gereksiz artırma gibi etik dışı bir uygulamanın ve kişilerin haksız akademik, vb. yarar sağlama davranışlarının önlenmesi için editör, yazarlardan her bir yazarın yazıya yaptığı katkının açıklanmasını isteyebilir ve bu bilginin yayınlanmasını uygun görebilir. Çok-merkezli çalışmalarda, yazı başlığının altında yazar olarak bildirilenlerin tümü, yazarlık için yukarıda belirtilen şartları yerine getirmelidir. Bu şartları taşımayan grup üyeleri, kendi izinlerinin de alınması koşuluyla, “Teşekkür” bölümünde belirtilebilir. Yazar sıralaması, tüm yazarların ortak kararına dayanmalıdır. Yazarlık sırasının belirlenmesindeki farklılıklardan dolayı, yazarlar tarafından aksi belirtilmedikçe, bildirilen sıra esas alınacaktır. Yazarlar, farklı bir sıralama sözkonusu olduğunda bu durumu dipnotla açıklayabilirler.
Yazarlarla ilişkili olabilecek ve bildirilmesi gereken diğer alanlar (conflict of interest) Herhangi bir yazıda, yayının değerlendirme kurulunda yer alan bir danışman ve yayın sürecinde rol alan yayıncı, yazar( lar), değerlendirmeci ve editör, kararlarını
uygunsuz şekilde etkileyebilecek çalışmaların içindeyse ya da bu tür çalışmalarla ilişkisini sürdürüyorsa, kararlarının tarafsız olup olmadığına ve konumunun bu kararlar üzerinde etkili olup olmadığına bakılmaksızın, bu kişi ve kişilerin ilişkili olduğu alan (conflict of interest) var demektir. Gerek kendi adına gerekse yakın aile bireyleri aracılığıyla, şirketlerle ve iş dünyasıyla mali ilişkiler (kurumlarda çalışma durumu, danışmanlık, hissedarlık, onursal üyelik, bilirkişilik, vb.) genellikle en önemli çakışma alanları olarak değerlendirilmektedir. Başka konularda da çakışma alanları doğabilir: Kişisel veya çıkar ilişkileri, akademik yarış ve rekabet, entellektüel hırs, vb. Danışmanlık sürecinin ve yayınlanan yazıların güvenilirliği, yazıların yazılma ve değerlendirilme aşamalarında ve editöryel kararlarda bu alan çakışmalarının nasıl ele alındığına bağlıdır. Çalışmaya ait bilimsel yöntem ve hükümlerle ilgili uygunsuzluklar ya da tarafgirlik dikkatli bir incelemeyle saptanabilir ve saf dışı edilebilir. Mali ilişkiler ve çıkar ilişkileri ve bunlardan doğabilecek etkilerin ise belirlenmesi daha zordur. Yazıların değerlendirilmesi ve yayın sürecinde görev alanlar ve bu yazıların hazırlanmasında sorumluluk üstlenen yazarlar, başka alanlarla olan ilişkilerini açıklamak zorundadırlar; böylece başkaları yayınlar üzerinde meydana gelebilecek olası etkileri değerlendirme olanağına kavuşmuş olur. Yazarlar, dergiye herhangi bir yazı gönderdiklerinde, çalışmanın tarafsızlığı ile ilgili bilinmesi gereken herhangi bir mali ya da diğer çakışma ve ilgi alanlarını açıklamakla yükümlüdürler. Ayrıca, yazıda çalışmaya yapılan tüm mali katkıları ya da sponsorlukları, çalışmayla ilgili yürütülen mali ya da kişisel ilişkileri açıklamalıdırlar. Bu açıklama, yayının gönderildiği sırada editöre yazılan mektupta da bildirilmeli ve kendilerinden istendiğinde gerekli belge ve izinler sunulmalıdır. Yazarlar ve çalışmayla ilgili herhangi bir çakışma alanı bulunmasa bile bu durum editöre yazılan mektupta açık bir şekilde bildirilmelidir. (*Kaynak: Uniform requirements for manuscripts submitted to biomedical journals. Ann Intern
Med 1997;126:36-47).
BU BÖLÜM EKSİKSİZ OL AR AK DOLDURULUP YANITL ANMALIDIR Yazar(lar) makalenin teslim edilmesi ve yayınlanması ile ilgili herhangi bir çıkar çatışması olup olmadığını ve bunun muhtemel sonuçlarını aşağıda açık biçimde belirtmelidirler. Yazar(lar) çalışma ile ilgili herhangi bir finansal destek alıp almadıklarını aşağıda açık biçimde belirtmelidirler.
Yazının başlığı: Yukarıda başlığı bildirilen yazımız, eş zamanlı olarak veya daha önce yayınlanmak ya da değerlendirilmek üzere herhangi bir dergiye gönderilmemiş, kısmen ya da tümüyle herhangi bir dergide yayınlanmamıştır. Aşağıda adı, soyadı, çalışmaya katkısı ve imzaları olan yazarlar yazının terminoloji bütünlüğü açısından radaksiyon ve dizgi işlemi sonrası son halini okumuşlar ve yazının bu şekilde yayımlanması için Türk İmmünoloji Dergisi’ne baskı onayı vermişlerdir. Yazarlar; Ad, Soyad
Çalışmaya katkısı
Tarih
İmza
1. .........................................................................................................
..........................................................................................
.............................................
.......................................................................
2. .........................................................................................................
..........................................................................................
.............................................
.......................................................................
3. .........................................................................................................
..........................................................................................
.............................................
.......................................................................
4. .........................................................................................................
..........................................................................................
.............................................
.......................................................................
5. .........................................................................................................
..........................................................................................
.............................................
.......................................................................
6. .........................................................................................................
..........................................................................................
.............................................
.......................................................................
7. .........................................................................................................
..........................................................................................
.............................................
.......................................................................
8. .........................................................................................................
..........................................................................................
.............................................
.......................................................................
İletişim Yazar Ad Soyad:
Kurum Telefon / Faks:
GSM:
e-posta:
................................................................................................................
..........................................................................................
.............................................
@ .......................................................................
ix
Turkish Journal of Immunology Türk İmmünoloji Dergisi
From The EDITOR Editörden
Sevgili arkadaşlarım, Dergimizin bu sayısında iki Endonezya, bir Bulgaristan, bir de Morocco’dan olmak üzere dört araştırma makalesi yer almaktadır. Bu sayımızdan itibaren yayın hizmetlerimiz BAYT Bilimsel Araştırmalar Basın Yayın ve Tanıtım Ltd. Şti. tarafından yürütülecektir. Bugüne kadar dergimize hizmet veren Bayçınar Tıbbi Yayıncılık Şirketine katkılarından dolayı çok teşekkür ederiz. Dergimizin yayın dili Türkçe ve İngilizce’dir. Dergimizin yayın kurallarına http://www.turkishimmunology.org/ tr/ adresinden ulaşabilirsiniz. Dergimizin kalitesi göndereceğiniz değerli çalışmalarla artacaktır, bugüne kadar vermiş olduğunuz desteğe teşekkür ediyor devamını diliyoruz. Saygı ve Sevgilerimle, Prof. Dr. Günnur DENİZ Editör
xi
ORIGINAL ARTICLE / ÖZGÜN MAKALE
Turkish Journal of Immunology - Open Access www.turkishimmunology.org Turk J Immunol 2017; 5(1):1−4
Mast Cells in Leprosy Patients with Reversal Reactions Tip 1 Reaksiyon Pozitif Lepra Hastalarında Mast Hücreleri Renni Yuniati1, Fatihatul FM2, Fika A2, Prasetyowati S1, Indropo A3
Abstract Background: Reversal reaction (RR) is an acute reaction on chronic episode which often contributes to withdrawal of treatment and disability in leprosy patients. Previous study showed that mast cells in reactive tuberculoid lesions biopsy material had lower density than non reactive tuberculoid lesions. Granulomatous lesions in leprosy patients with high mast cells density were more likely to progress into severe reversal reaction. Objective: To examine mast cells level in reversal reaction patients (RR) and non-reactional leprosy patients (non-RR) Methods: Fiftysix leprosy patients consist of 28 with reversal reactions and 28 non-reactional leprosy were assessed for mast cells levels by immunohistochemistry staining. The mast cell numbers in both groups were analyzed using Independent T-test. Results: Mast cells were increased in the reversal group (p<0.05). Conclusion: Mast cells level is associated with reversal reaction of leprosy. Keywords: Leprosy, reversal reaction, mast cell
Öz Giriş: Tip 1 reaksiyon, genel olarak lepra hastalarında hareket kısıtlılığı ve tedavinin kesilmesi ile ilişkili olan, kronik lepra hastalığının akut bir reaksiyonudur. Çalışmalar, reaktif tüberküloid lezyonlardan alınan biopsi materyallerinde, reaktif olmayan tüberküloid lezyonlarındakine göre daha az mast hücresi olduğunu göstermiştir.Lepra hastalarının granülomatöz lezyonlarındanda dansitesi çok yüksek olarak saptanan mast hücreleri, muhtemelen Tip 1 reaksiyona neden olmaktadır. Lecturer of Department of Dermatology and Venereology, Medical Faculty Diponegoro University, Semarang, Indonesia. 2 Bachelor of Medicine, Medical Faculty Diponegoro University, Semarang, Indonesia. 3 Lecturer of Department of Dermatology and Venereology, Medical Faculty Airlangga University, Surabaya, Indonesia. 1
Correspondence: Renni Yuniati Diponegoro University, Dermatology, Kudus, Indonesia Tel: ++628122847008 e-mail:
[email protected] Received: February 17, 2017 Accepted: April 05, 2017 doi: 10.25002/tji.2017.542 ©2017 Turkish Journal of Immunology. All rights reserved.
Amaç: Tip 1 reaksiyon gösteren hastalar ile göstermeyen hastaların mast hücresi düzeylerini araştırmak. Yöntemler: Reaksiyonu oaln 28 hasta ile reaksiyon göstermeyen diğer 28 hasta, immünhistokimya boyaması ile saptanan mast hücreleri açısından irdelendi. Her iki gruptaki mast hücresi sayıları, Student-t testi ile karşılaştırıldı. Bulgular: Reaskiyon gösteren grupta mast hücreleri istatistiksel olarak anlamlı düzeyde daha fazla idi (p<0.05). Sonuç: Lepra hastalarında, mast hücreleri tip 1 reaksiyon ile ilişkilidir. Anahtar Kelimeler: Lepra, Tip 1 reaksiyon, mast hücresi
Introduction Leprosy is a curable chronic infectious disease which can cause severe morbidity associated with disability. Leprosy is caused by intracellular obligate bacteria, Mycobacterium leprae. M.leprae infects peripheral nerve, skin, oral mucosa, upper respiratory airway, reticuloendothelial system, eyes, muscles, bone, testicles, and all of human organs other than central nervous system. Leprosy reactions are acute exacerbations that manifest as activation of constitutional symptoms and/or new skin efflorescence. There are two types of leprosy reactions: type 1 (Reversal Reaction/RR) and type 2 (Erythema Nodosum Leprosum/ENL).[1]
1
2
Turk J Immunol 2017; 5(1):1–4
Reversal reaction (RR) is type IV hypersensitivity reaction which frequently occurs in borderline type leprosy as a result of cellular immune response to M.leprae antigen and characterized as an acute inflammation of the former skin lesion. Approximately 95% of RRs occur simultaneously with diagnosis confirmation or during multi-drug treatment (MDT). RR commonly appears on the first six-month treatment, particularly in the borderline tuberculoid (BT) and borderline borderline (BB) leprosy. It can also be found in borderline lepromatous (BL) leprosy with longer interval of MDT. Clinical manifestation of RR includes abrupt increase in number and more active lesions with/without ulceration, edema, neuritis, and permanent nerve damage. Bacterial index (BI) is frequently negative or remarkably decreased in RR patients. Leprosy patients commonly complain about skin lesion enlargement which is aesthetically disturbing. This causes treatment withdrawal since patients consider it as a treatment failure.[1,2] Mast cell is a constant cellular component on dermis, lamina propria of mucous, serous, and connective tissues.[3] In the tissue damage, mast cell degranulation and release of inflammation mediator cause increase in vascular permeability, local edema, leukocyte activation, tissue destruction, and eventually skin lesion as a result of inflammation response. Chowdory and Gosh showed that mast cell in the reactive tuberculoid lesion biopsy had lower density than non-reactive tuberculoid lesions. [4] Several studies also found that granulomatous lesions in leprosy patient with high density level of mast cells were more vulnerable to become severe RRs.[4,5] There were no studies which explain roleplay of mast cells in immunoinflammatory processes in RR and non-RR leprosy patients.
leprosy patients treated at the Donoharjo Hospital, Jepara. Subject selection has been done by consecutive sampling with double-blind method. Participants were multibacillary leprosy patients who met WHO criteria and aged between 20 and 60 years. Participants were divided into two groups: leprosy patients with RR, and leprosy patients without RR. Written informed consents were obtained from all participants. Exclusion criteria included pregnancy and other acute inflammatory diseases. Based on the sample calculations, total subjects in this study were 56 samples in two groups: leprosy patients with RR (n=28), and leprosy patients without RR (n=28). Mast cell levels were measured by immuno-histochemistry staining using monoclonal antibodies to Human Mast Tryptase antibody (Leica Biotech). It was visualized by DAB, and calculated by observing 20 fields of view in 100x magnifications. The mast cell levels in both groups were respectively analyzed using independent samples T-test. The data were analyzed using normality and homogeneity test for age and occupation. Confounding factors in this study were controlled by randomization processes. The data were considered significant if p<0.05 with confidence interval 95%. This study was approved by Ethics Committee of Faculty of Medicine, University of Airlangga.
Results On the average, the age of studied participants, also number of men and women in control group were not much different from RR group (Table 1). There was a significant increase (p<0.0001) in the expression of mast cells in RR group (mean=20.86) compared with the non-RR (mean=9.29) (Table 2).
Materials and Methods Research design in this study was analytic observational with cross sectional assessment. Subjects were multi-bacillary Table 1. Characteristics of subjects
Non-RR
RR
N
28
28
Age
Mean ± standard deviation
41.00 ± 8.26
42.43 ± 9.13
Sex
Male
15 (53.6%)
12 (42.9%)
Female
13 (46.4%)
16 (57.1%)
3
Munita et al. n Mast Cells in Leprosy Patients with Reversal Reactions
(a)
(b)
Figure 1. a, b. The figures show mast cells that give a positive reaction to anti-mast cells through immuno-histochemical staining (x400). NonRR group (a); RR group. Black arrows indicate the double stained anti-mast cells. Red arrows indicate the mast cells that does not give positive reaction.
The mean numbers of mast cell/20 fields
Table 2. Results of independent samples T-test Groups
n
Mean ± sd
Non-RR
28
9.29 ± 2.07
RR
28
20.86 ± 4.92
p 0.000
RR: Reversal Reaction
Figure 2. The histogram above shows increased expression of mast cells in RR group compared to those with non-RR.
Discussion This study was conducted to explain the actual role of mast cells in leprosy RR. Theoretically, RR in terms of micro-organism destruction is a positive factor, as it occurs massively. However, it is clinically dissatisfying because of acute inflammatory reaction which is aesthetically disturbing.[6] RR is marked by delayed hypersensitivity to M.leprae antigen (Gell & Coombs type IV reaction), and an abrupt increase in immune cell response.[6] There was an increase in dermis lymphocyte with the disappearance of normal granuloma structure that would decrease bacterial effectivity. In addition, Langhans giant cell could be observed in the next stage of RR.[7,8] RR affects 20–30% of leprosy patients.[6]
This research showed that there was a significant difference (p<0.05) of mast cells in both groups. There was an increase in mast cell amount as well as its activity. Previous studies examined the relationship between mast cells and lepra bacilli in the foot skin of immunosuppressed mice inoculated by leprosy bacilli. The study showed that there were changes in the structure and morphology of mast cells in which the structural changes were caused by direct infection of leprosy bacilli, whereas the morphological changes such as mastocytosis and massive degranulation were responses to the leprosy bacilli. Changes in density and massive degranulation is commonly found on mast cells in the skin, the affected nerves, muscles, and blood vessels. In human studies involving 118 untreated leprosy cases and 20 healthy individuals, there were a minimal number of mast cells in healthy individuals. The number of mast cells significantly increased in cases of leprosy (p<0.01) and particularly greater in lepromatous leprosy (LL) type (p<0.05). There is also an increase in degranulation and morphological changes in LL type. These changes can be caused by the
4 release of cytokines from T lymphocytes. In addition, protease release from mast cells may play a role like plasma proteins such as albumin to form a histamine release peptide that will further trigger the activation of mast cells and inflammation. Another study found that the mast cell count in the tuberculoid leprosy group was significantly lower than that in the LL group.[8] LL type had mast cells with the lowest density compared to the BT and BB type. High density mast cells in BT and BB type refer to the role of mast cells in the activation of immune response to M.leprae infection.[9,10] Further study showed that Hsp70 which induced mast cell activity was detected in skin and nerve lesions from all leprosy patients but particularly prominent in lesions from patients undergoing RRs.[11] Mast cells have been known to induce variety of cytokines, such as TNF-α, IL-1, IL-4, IL-5, IL-6, and GM-CSF. Bagwan et al. found that mast cells in LL type were denser than TT type. It was associated with Th2 predominant as a cytokine response in LL type, and Th1 predominant in TT type.[12] Moreover, in BL type, both Th1 and Th2 were produced consistent with mast cell density in the lesion; so that could explain the high incidence of RR in this type. It was found that there were many spindled and elongation of mast cells in BT type which indicated that mast cells were ready to degranulate.[10] In this study, there were some limitations such as research design and method of identifying mast cell levels that could affect the study results. The authors suggest future prospective study and other methods such as polymerase chain reaction (PCR) for identifying mast cell levels and role in leprosy patient with RR. There are also a lot of variables associated with RR that could not be assessed in this study by the cause of lack of funding. In addition, insufficient literature about variables studied in leprosy patients lead to the difficulty in determining the normal values. This study is not a discussion about the prevention of mast cell degranulation which will prevent RR on leprosy, anti-inflammation drugs on RR, mast cells role on RR in patients who have completed MDT. That may be the consideration of future studies. ACKNOWLEDGMENTS The authors would like to express their gratitude to Department of Dermatology and Venereology, Diponegoro University and Donorejo Hospital, Jepara.
Turk J Immunol 2017; 5(1):1–4
References 1. Naafs B, van Hees CL. Leprosy type 1 reaction (formerly reversal reaction). Clin Dermatol 2016;34:37–50. doi: 10.1016/j. clindermatol.2015.10.006 2. Walker SL, Lockwood DN. Leprosy type 1 (reversal) reaction and their management. Lepr Rev 2008;79:372–86.
3. Abraham SN, St John AL. Mast Cell-orchestrated Immunity to Pathogens. Nat Rev Immunol 2010;10:440–52. doi: 10.1038/ nri2782 4. Chowdhury SK, Ghosh S. Distribution of tissue mast cells in “reaction in tuberculoid leprosy”. Bull Calcutta Sch Trop Med 1968;16:13–4. 5. Chatura KR, Sangeetha S. Utility of Fite-Faraco stain for both mast cell count and bacillary index in skin biopsies of leprosy patients. Indian J Lepr 2012;84:209–15.
6. Scollard DM, Joyce MP, Gillis TP. Development of leprosy and type 1 leprosy reactions after treatment with infliximab: a report of 2 cases. Clin Infect Dis 2006;43:e19–22. doi: 10.1086/505222 7. Ridley DS, Jopling WH. Classification of leprosy according to immunity. A five-group system. Int J Lepr Other Mycobact Dis 1966;34(3):255–73.
8. Aroni K, Kontochristopoulos G, Liossi A, Panteleos D. An investigation of mast cells in two basic leprosy groups. Int J Lepr Other Mycobact Dis 1993;61:634–5. 9. Kumar R, Vaidya MC. Mast cell and Mycobacterium leprae in experimental leprosy. Hansenol Int 1982;7:1–7. 10. Mysorekar VV, Dandekar CP, Rao SG. Mast cells in leprosy skin lesions. Lepr Rev 2001;72:29–34.
11. Khanolkar-Young S, Young DB, Colstont MJ, Stanley JN, Lockwood DN. Nerve and skin damage in leprosy is associated with increased intralesional heat shock protein. Clin Exp Immunol 1994;96:208–13. 12. Bagwan IN, Khandekar MM, Kadam P, Jadhav MV, Deshmukh SD. A study of mast cells in granulomatous lesions of skin, with special emphasis on leprosy. Indian J Lepr 2004;76:31–7.
ORIGINAL ARTICLE / ÖZGÜN MAKALE
Turkish Journal of Immunology - Open Access www.turkishimmunology.org Turk J Immunol 2017; 5(1):5−12
The Increase in LEAP-2 mRNA Suggests a Synergistic Probiotics-Doxycycline Interaction in Chickens LEAP-2 mRNA’sındaki Yükselme, Piliçlerde Probiotikler ile Doksisiklin Arasındaki Sinerjik İlişkiyi İşaret Etmektedir Ivelina Pavlova1, Aneliya Milanova1
Abstract Background: Extensive interaction between gut microbiota and the host immune system has significant impact on chicken performance. Objective: Therefore, the influence of doxycycline, administered with or without Lactobacillus spp., on PepT1 and LEAP-2 mRNAs expression in duodenum, jejunum and liver was investigated in Duc chickens. Methods: One-day-old Duc broiler chickens were divided in four groups. Chickens without treatment served as controls. Five days after hatching the second group was treated with Lactobacillus brevis, L.plantarum and L.bulgaricus probiotics via feed for 15 days. The third group was treated with probiotics (as in group 2) and doxycycline (10 mg/kg bw, via drinking water for five days, started 15 days after hatching). The fourth group received antibiotic only as described above. Water and food (broiler starter without drugs) were supplied ad libitum. Samples from liver, duodenum and jejunum were collected at the end of the treatment with doxycycline (21 days after hatching). Expression levels of LEAP-2 and PepT1 mRNAs were determined by qRT-PCR. Results: Doxycycline administered alone or in combination with probiotics, provoked a statistically significant upregulation of LEAP-2 mRNA in the liver and in the duodenum. Abundance of PepT1 mRNA was increased in the duodenum. Administration of doxycycline alone caused a moderate induction of LEAP-2 mRNA and down-regulation of PepT1 mRNA in the liver. Conclusion: Up-regulation of the studied antimicrobial peptides provoked by combination of Lactobacilli and doxycycline might be beneficial in terms of host protection. Keywords: Doxycycline, LEAP-2 mRNA, PepT1 mRNA, chicken, Lactobacillus probiotics
Öz Genel Bilgi: Barsaktaki mikrobiata ile konağın bağışıklık sistemi arasında olan ilişki, piliçlerin verimliliğine önemli derecede etki eder. Department of Pharmacology, Physiology of Animals and Physiological Chemistry, Faculty of Veterinary Medicine, Trakia University, Stara Zagora, Bulgaria
1
Correspondence: Ivelina Pavlova Department of Pharmacology, Physiology of Animals and Physiological Chemistry, Faculty of Veterinary Medicine, Trakia University, 6000 Stara Zagora, Bulgaria Tel: +35942699552 e-mail:
[email protected] Received: February 13, 2017 Accepted: April 13, 2017 doi: 10.25002/tji.2017.541 ©2017 Turkish Journal of Immunology. All rights reserved.
Amaç: Laktobasil tipi bakterilerin verildiği ve verilmediği, doksisiklin verilen Duc piliçlerde duodenum, jejunum ve karaciğerde PepT1 ve LEAP-2 mRNA ifadeleri araştırıldı. Yöntemler: 1 günlük Duc etlik civcivler 4 gruba ayrıldı. Tedavi verilmeyen civcivler kontrol grubu olarak alındı. Yumurtadan çıktıktan 5 gün sonra ikinci gruba Lactobacillus brevis verildi. L. plantarum ve L.bulgaricus probiotikleri 15 gün boyunca verildi. Üçüncü gruba ikinci gruba olduğu gibi, probiotik ile birlikte doksisiklin(yumurtadan çıktıktan sonra 15. günde içtikleri suya karıştırarak 10 mg/kg vücud ağırlığı olacak şekilde) uygulandı. Dördüncü grup, yukarıda tanımlandığı şekilde sadece antibiyotik aldı. Civvicler, suyu ve yiyeceği serbest olarak (ad libitum) aldı. Doksisiklin tedavisi bittikten sonra (yumurtadan çıktıktan 21 gün sonra) karaciğer, duodenum, jejunum ve karaciğerden örnekler alındı. LEAP-2 ve PepT1 mRNA düzeyleri qRT-PCR ile ölçüldü. Bulgular: Tek başına ya da probiotikler ile birlikte verilen doksisiklin, karaciğer ve duodenumda anlamlı ölçüde LEP-2 mRNA’sı sentezine yıl açtı.PepT1 mRNA’sı artışı en çok duodenum’dan alınan örneklerde görüldü. Sadece doksisiklin verilmesi karaciğerde LEAP-2 mRNA üretiminde hafif bir artışa ve PepT1 mRNA düzeyinde düşüşe neden oldu. Sonuç: Laktobasil ve doksisiklin kombinasyonu ile sentezi arttırılan antimikrobial peptidler, konağın infeksiyondan korunmasına yardımcı olabilir. Anahtar Kelimeler: Doksisiklin, LEAP-2 mRNA, PepT1 mRNA, piliç, Lactobacillus probiotikler
Introduction Doxycycline is a second generation, semisynthetic broad spectrum antibiotic, used for many years in treatment of bacterial diseases in farm animals.[1] It has some advantages over
5
6 other tetracycline antibiotics such as higher bioavailability after oral administration together with lower affinity to Ca2+ ions, better penetration in tissues, and longer halflife of elimination, and lower MIC values against many Gram-positive and Gram-negative pathogens for poultry. [2–5] This antibacterial drug showed good stability in water solutions which is favorable for oral treatment of big groups of animals.[6] Doxycycline is widely used in poultry due to its efficacy in treatment of diseases caused by pathogenic bacteria such as Staphylococcus pyogenes, Streptococcus spp., Escherichia coli, Enterobacter, Klebsiella, Haemophilus influenza, Pseudomonas aeruginosa, Chlamydia, Mycoplasma and Rickettsiae spp.[7,8] Apart from the problem with antibacterial resistance against tetracyclines[9,10], their administration is related to rapid changes in microbiota composition with increase in the number of microorganisms such as Escherichia coli and Enterococcus spp.[11] Administration of probiotics is often used for restoration of microbiota complexity after therapy with antibiotics.[12] Several studies characterized Lactobacillus spp. as suitable probiotic strains for poultry.[13,14] Probiotics used routinely in poultry lead to better body weight gain, lower feed conversion ratio (FCR) and decreased mortality.[15,16] Part of these effects can be attributed to the changes in the expression levels of transporter proteins such as Na+/glucose cotransporter (SGLT-1) and P-glycoprotein (P-gp).[17] Additional benefit from probiotics supplementation to poultry feed is production of small molecules with antibacterial properties called bacteriocins and defensins.[18–20] Their influence on the function of the immune system through modulation of the microbiota in the gastrointestinal tract and through activation of Toll-like and NOD-like receptors has been described.[21] LEAP-2 was described in poultry and it was recognized as an antimicrobial peptide with activity against Salmonella spp., Streptococcus spp., and Staphylococcus spp.[22,23] PepT1 is responsible for peptide absorption from gastro-intestinal tract which is related to feed utilization in poultry.[24] Its expression can be influenced by the microbiota in the gastro-intestinal tract and is down-regulated by Cl. perfringens.[25] Although increased knowledge on the effect of gastro-intestinal health and its impact on the performance of broilers there are no published data about the influence of probiotics and antibiotics on the expression of PepT1 and LEAP-2 mRNAs.
Turk J Immunol 2017; 5(1):5–12
Therefore, the present study was designed as a pilot investigation of the effect of doxycycline administered with or without Lactobacillus plantarum 11, Lactobacillus brevis 51 and Lactobacillus bulgaricus 13 as well as the combination of these strains on the expression of PepT1 and LEAP-2 mRNAs in the duodenum, jejunum and liver of Duc broiler chickens.
Materials and Methods Drugs Doxycycline hyclate (Doxy-200 ws. Interchemie, Venray, Holland, Serial No: 255292/05–2015). Each 1 g of doxycycline contained 200 mg doxycycline hyclate.
Microbial cultures Lactobacillus brevis 51, L.plantarum 11 and L.bulgaricus 13 (Microbial Collection-Laboratory of Genetics of Probiotic Bacteria, Institute of Microbiology, BAS) were used as probiotic strains. They were natural isolates from traditional dairy products and showed scientifically proven probiotic potential, a broad spectrum of antimicrobial activity and examined molecular mechanisms of the possible healthful effects.[26] They were characterized as candidate probiotics according to the in vitro criteria of WHO.[27,28] The Lactobacillus strains were cultured overnight at 37°C in De Man, Rogosa and Sharpe (MRS, Merck, Germany) broth under anaerobic condition (BBL® Gas Pak Anaerobic System Envelopes, Becton Dickinson). Exponential cultures of the investigated strains were used separately to inoculate 10% (w/v) sterile skimmed milk (Humana, Holdorf, Germany). After an overnight cultivation process at 37°C they were lyophilized, and stored at -20°C until administration to the chickens. Each mg of the lyophilized L.brevis 51 contained 1.6x106 CFU/mg, L.plantarum 11 1.06x106 CFU/mg lyophilized product and L.bulgaricus 13–0.25x103 CFU/mg. The viability of the used strains lactobacilli was tested after the lyophilization and before the in vivo assays by a standard plate count procedure using MRS agar.
Animals and experimental design The experimental procedure was approved by the Ethical committee at Trakia University, Stara Zagora (Reference No: 65/18.10.2013). The euthanasia of the chickens was done according to Regulation No: 20/01.11.2012.
Pavlova and Milanova n The Increase in LEAP-2 mRNA Suggests a Synergistic Probiotics-Doxycycline Interaction in Chickens
7
Table 1. Experimental design of the study with Duc broiler chickens Experimental groups
Probiotics in the feed
Doxycycline (10 mg/kg via water)
Sampling for qPCR analysis
Group 1
Not supplied
Not administered
On 21-st day after hatching, n=6
Group 2
Supplied for 15 days from 6-th to 20-th day after hatching
Not administered
On 21-st day after hatching, n=6
Group 3
Supplied for 15 days from 6-th to 20-th day after hatching
Treated for 5 days, from 16-th day to 20th day after hatching
On 21-st day after hatching, n=6
Group 4
Not supplied
Treated for 5 days, from 16-th day to 20th day after hatching
On 21-st day after hatching, n=6
One-day-old Duc chicks (n=120) were included in the experiment. They were equally divided in four groups, ten animals per pen, three pen for each group. They were kept according to the species requirements, at 24 h lighting regimen and room temperature between 26 and 28°C (temperature under the lights between 35 and 30°C according to the age of the chickens). Water and food (broiler starter without drugs) were supplied ad libitum. The chickens were clinically healthy and any signs of disease were not observed. First group was used as control and it was not treated. Second group was treated with probiotics at a rate of 1 g of each probiotic strain per kg feed. Probiotics supplementation started 5 days after hatching and lasted 15 days. The probiotic strains were stored at -20°C until delivery to the chickens and they were added daily to the feed. Feed with probiotics was administered each morning between 7.30 and 8 h. Third group received a combination of probiotics as described above and doxycycline orally at a dose of 10 mg/kg body weight via drinking water. The treatment with doxycycline started 15 days after hatching and lasted five consecutive days. Chickens from the fourth group were treated with doxycycline only with the same dosage regimen as in the third group. Each day, the solutions in drinking water were freshly prepared between 7.30 and 8 h in the morning and between 16 and 17 h in the afternoon. The ingested dose of doxycycline did not differ from aimed dose of 10 mg/kg. The medicated water was administered ad libitum. Consumption of water was measured, and the body weight of the animals was registered. Feed consumption and body weight of the chickens were measured every day and average daily gain and FCR were calculated. These data were collected for all of the chickens included in the experiment.
Six chickens from each group (Table 1) were euthanized by cervical dislocation 126 hours after the beginning of the treatment with doxycycline. Tissue samples from liver, duodenum and jejunum were collected. They were snapfrozen in liquid nitrogen and stored at -70°C until RTPCR analyses.
RNA isolation and RT-PCR analysis Total RNA was isolated by using TriReagent for DNA and protein extraction (Genaxxon bioscience GmbH, Lot-No. 3T004856). Tissue samples were homogenized in 0.6 mL TRItidy G for 10–20 sec. The lysate was centrifuged at 12000 g for 10 min at 4°C and the upper aqueous phase was transferred to a new sterile tube which was incubated at 25°C for 5 min. Then 0.2 mL chloroform was added, the tubes were incubated for 30 min at 30°C and centrifuged at 12000 g for 15 min at 4°C. The upper aqueous phase was transferred in a sterile tube and 500 µL isopropanol was added. The organic phase with the DNA was centrifuged at 12000 g for 15 min at 4°C and the residual aqueous supernatant was removed. The pellets were washed with 1 mL 75% ethanol by vortexing and subsequently with absolute ethanol, then they were centrifuged at 7500 g for 5 min at 4°C. The ethanol was removed and after drying the RNA was dissolved in 20 µL DEPC-treated water. After that the tubes were incubated at 55–60°C for 10 min. RNA concentrations were measured with spectrophotometer A260/280 and stored at -70°C until reverse transcription. Single-stranded cDNA was synthesized from 3 µg total RNA using the First Strand cDNA Synthesis Kit (Fermentas Life Science) on a Quanta Biotech QB-96 (Quanta Biotech Ltd., Surrey, United Kingdom). The reaction mixture (total volume 20 µL) was incubated according to the manufacturer’s instructions: for 60 min at 37°C, and then the enzyme
8
Turk J Immunol 2017; 5(1):5–12
Table 2. Specific gene primers in poultry used in the study Gene
NCBI accession number
Forward (F) and reverse (R) primers, 5′→3′
Ta, °C
LEAP-2
NM_001001606.1
F: CTCAGCCAGGTGTACTGTGCTT R: CGTCATCCGCTTCAGTCTCA
65
PepT1
AY029615.1
F: CCCCTGAGGAGGATCACTGTT
58.7
R: CAAAAGAGCAGCAGCAACGA HPRT H6PD
NM_204848 XM_425746.4
65 64
F: GATATCCCACACTTCGAGGAG R: CGTTGCTGTCTCTACTTAAGCAG F: GAGAACCAGCACTTCTTAGAC R: GGGTTCAGCAACTCCACTG
LEAP-2, liver expressed antimicrobial peptide; PepT1, peptide transporter 1; HPRT, hypoxanthine phosphoribosyltransferase; H6PD, hexose-6-phosphate dehydrogenase; NCBI, the National Centre for Biotechnology Information; Ta, optimal annealing temperature.
was heat inactivated at 70°C for 5 min and the reaction mixture rapidly cooled to 4°C. Specific primers for chicken PepT1 and LEAP-2 were used for RT-PCR (Table 2). Sybr Green method was applied for the real-time PCR analysis by using iQTM Sybr Green Supermix (Cat. No. 170–8885, Bio-Rad, Hercules, CA). iCycler iQ system (Bio-Rad, Hercules, CA) was used for RT-PCR and MyiQ System Software, v.1.0.410 (Bio-Rad Laboratories Inc.) was applied for analysis of results. Each reaction went through a PCR cycle with a denaturation
step at 95°C for 20 s, an annealing step specific for each set of primers for 30 s and an elongation step at 72°C for 30 s. After 35 cycles a melting curve was obtained by increasing the temperature with 0.5°C every 10 s from 6°C to 95°C demonstrating the formation of only one product. Efficiencies for each reaction were estimated by LinRegPCR 7.0 software. Relative gene expression level was assessed using the algorithm described by Vandesompele et al.[29] HPRT and H6PD (Table 1) were used as reference genes for the normalization of the expression levels of gene of interest.
1
Control
Relative expression level
b a 0.1
a
a
a
Probiotics
b
Probiotics and Doxycycline Doxycycline
a b
b
0.01
Liver
Duodenum
Jejunum
Figure 1. Relative expression levels of PepT1 mRNA in Duc broiler chickens, treated orally with doxycycline at a dose rate of 10 mg/kg via drinking water for 5 consecutive days with or without Lactobacillus probiotics. The experimenal groups were control (n=6), probiotics treated group (n=6), doxycycline and probiotics received chickens (n=6) and doxycycline treated group (n=6). Different latters indicate, statistically significant differences between groups for each tissue at P<0.05. The absence of letters and the same letters show lack of statistically significant differences between the groups.
Pavlova and Milanova n The Increase in LEAP-2 mRNA Suggests a Synergistic Probiotics-Doxycycline Interaction in Chickens
b
1
b Control
a
Probiotics
c
a Relative expression level
9
Probiotics and Doxycycline Doxycycline
a b
0.1
0.01
a
Liver
a
Duodenum
Jejunum
Figure 2. Relative levels of expression of LEAP-2 mRNA in Duc broiler chickens treated orally with doxycycline at a dose rate of 10 mg/kg via drinking water for 5 consecutive days with or without Lactobacillus probiotics. The experimental groups were control (n=6), probiotics treated group (n=6), doxycycline and probiotics received chickens (n=6) and doxycycline treated group (n=6). Different letters indicate satistifically significant differences between groups for each tissue at P<0.05. The absence of letters and the same letters show lack of statistically significant differences between the groups
Statistical analysis The data were analyzed with Mann-Whitney nonparametric test (Prism 4.0 software) after a test for normal distribution. Effect of the different treatments on mRNA expression levels of the studied genes was evaluated. Data for each tissue were analyzed separately and comparison between different treatments was performed for each tissue. Differences were considered as statistically significant at p<0.05.
Results PepT1 mRNA expression was found in the studied tissues in healthy Duc broilers (Figure 1). Administration of Lactobacillus probiotics resulted in a tendency to upregulation of PepT1 mRNA in all investigated tissues. Combination of doxycycline and probiotics lead to its significant up-regulation in the duodenum if compared to the control and probiotics supplemented groups. The same changes were observed in the duodenum of doxycycline treated chickens. Opposite results were observed in the liver, where PepT1 mRNA was significantly downregulated in doxycycline treated group in comparison to the controls and probiotics treated poultry. Doxycycline administration provoked significantly lower levels in the
jejunum than the probiotics supplementation. Increased levels of PepT1 mRNA in the duodenum are accompanied by the lower FCR in the groups treated with doxycycline in comparison to the controls and group that received probiotics. The body weight at the end of the experiment was the lowest in control group (424.06±49.20 g) and the FCR was 1.84±0.28 kg/kg (coefficient of variation, CV=14.14%), followed by the probiotic treated group (435.75±41.53 g) with FCR 1.91±0.22 kg/kg and CV 11.62%. Chickens treated with doxycycline and probiotics had the highest body weight of 496.84±68.19 g and the lowest FCR (1.67±0.33 kg/kg, CV 13.66%) and these, that received the antibiotic only were 464.84±68.48 g with FCR 1.79±0.34 kg/kg and CV 16.87%. Administration of doxycycline provoked significant increase in LEAP-2 mRNA expression in the liver. Levels of LEAP-2 mRNA expression in the duodenum were significantly up-regulated in both groups treated with the antibiotic (Figure 2). LEAP-2 mRNA expression in the jejunum was statistically up-regulated in probioticsdoxycycline treated group compared to the control and probiotics treated group. Its expression in doxycycline treated chickens was down-regulated to the levels of control and probiotics group. Similar results were observed in the duodenum.
10 Discussion Published literature show a lot of data about pharmacokinetic properties and susceptibility of pathogenic bacteria to doxycycline in poultry. Influence of the treatment with this broad spectrum antibiotic on microbiota of gastro-intestinal tract with decrease in number of Lactobacillus spp. was also described.[30] These changes were related to the gain of body weight. Previous studies investigated the effect of heat stress of broiler chickens or administration of Lactobacillus plantarum in mice on the mRNA expression of nutrient transporters (including PepT1)[31,32] but the effect of Lactobacillus probiotics and doxycycline on the expression of PepT1 is not studied yet. Therefore, in this study effect of doxycycline treatment with or without Lactobacilli supplementation on the mRNA expression level of the peptide transporter PepT1 was investigated due to its importance in protein utilization and weight gain in broilers. PepT1 mRNA was found in the duodenum, jejunum and the liver of Duc broilers as has been previously described by Gilbert et al.[33] Administration of combination of Lactobacillus plantarum 11, L.brevis 51 and L.bulgaricus 13 in our study did not change the expression level of PepT1 mRNA in the studied tissues which was accompanied by a tendency to higher body weight and slightly higher values of FCR. Lactobacillus plantarum restored the decreased expression of PepT1 mRNA in the gastro-intestinal tract of mice with colitis to the levels of healthy animals.[31] The results in our study demonstrate that Lactobacillus plantarum 11, L.brevis 51 and L.bulgaricus 13 support the health in the intestines of Duc broilers through keeping the expression of PepT1 mRNA as in healthy controls. Statistically significant up-regulation of PepT1 mRNA in the duodenum and the tendency to increasing in the other two tissues in doxycycline-probiotics treated broilers can be discussed as positive influence on peptide absorption which resulted in the highest body weight and the lowest FCR in this group. Previous studies found the positive relationship of increased expression of PepT1 mRNA and feed utilization due to the role of PepT1 in absorption of diand tripeptides.[33] Effect of doxycycline on PepT1 mRNA level can be attributed to its possibility to modulate the expression of the studied gene. The expression of PepT1 mRNA can be modulated by stress conditions in broilers or feed restriction as well as drug administration such as 5-fluorouracil and clonidine.[34–37] Furthermore, some frequently used pharmaceutical excipients like Tween 20 and Tween 80 exert inhibitory effects on the expression of PepT1.[38] Up-regulation of PepT1 mRNA, lower FCR
Turk J Immunol 2017; 5(1):5–12
ratio with higher body weight in the group of docycycline treated Duc broilers in comparison to controls can be explained by the effect of doxycycline administration. Doxycycline treatment has been associated with increased weight gain in humans due to changes in the microbiota in gastro-intestinal tract.[30] Our data about the influence of this antibiotic can be related not only to PepT1 mRNA expression but also to changes in the microbiota in the intestines of poultry. Efficiency in the poultry industry depends on the health of the birds, respectively, on the function of the immune system. Antimicrobial peptides such as LEAP2 are recognized as part of innate immunity and their expression can be changed by pathogens.[39] Infection with Salmonella enteritidis resulted in up-regulation of LEAP-2 mRNA but Eimeria tenella caused its significant down regulation.[40,41] Shao et al.[42] demonstrated that Salmonella enteritidis up-regulated LEAP-2 mRNA in the jejunum of broiler chickens and that supplementation of yeast ß-D-glucans restored expression of LEAP-2 mRNA to the levels of healthy birds. These levels were not affected in healthy chickens.[42] Unlike the effect of pathogens, supplementation of beneficial bacteria from Lactobacillus spp. to Duc broilers did not provoke changes in the expression of LEAP-2 mRNA. Similar data were observed in broilers, treated with Lactobacillus acidophilus, Bifidobacterium bifidum and Enterococcus faecalis.[43] Significant up-regulation of LEAP-2 mRNA in the duodenum of the chickens treated with doxycyclineprobiotics combination and same tendency in the jejunum and liver can have positive impact on the innate immunity and disease resistance. Doxycycline administration resulted in significant up-regulation of LEAP-2 mRNA in the liver and in the duodenum in comparison to the controls and probiotics supplemented group. Its levels were further up-regulated in the intestines when the antibiotic was combined with probiotics. Although the lower expression in antibiotic administered animals if compared to the group treated with the combination doxycycline-probiotics, our data allow us to conclude that the benefit of doxycycline treatment can be enhanced by increase of antimicrobial peptide. It is difficult to compare the results from the current study due to absence of published data about such effects of doxycycline. In vitro investigation with Caco2 cells and RAW 264.7 macrophages, and in vivo rat model of colitis supports the potential use of doxycycline in association with the probiotic Saccharomyces boulardii for the treatment of inflammatory bowel diseases due to
Pavlova and Milanova n The Increase in LEAP-2 mRNA Suggests a Synergistic Probiotics-Doxycycline Interaction in Chickens
their anti-inflammatory effect.[44] In conclusion, finding combinations between probiotics and antibiotics that work synergistically in the stimulation of the host immune system would be a great relevance for the clinical practice in poultry husbandry. The results from this pilot study have to be further validated in functional studies and in experimental conditions with diseased animals in order to suggest the right doses of Lactobacilli and doxycycline. Conclusion Doxycycline administered alone and in combination with the three strains lactic acid bacteria led to significant upregulation of PepT1 and LEAP-2 mRNAs in the duodenum in Duc broilers which contribute to better feed utilization and stimulation of innate immunity. These changes can have positive impact on health of broilers and they have to be further validated in models of economically significant bacterial diseases of chickens. CO-AUTHOR CONTRIBUTIONS The both co-authors contributed equally to the work being described.
ACKNOWLEDGEMENTS The authors would like to thank to Prof. J. Fink-Gremmels, Utrecht University, the Netherlands for support in molecular analysis and to Assoc. Prof. Sv. Danova, Institute of Microbiology, BAS, Bulgaria, who kindly selected and prepared Lactobacillus spp. probiotics.
References 1. Chopra I, Roberts M. Tetracycline antibiotics: Mode of action, applications, molecular biology, and epidemiology of bacterial resistance. Microbiol Mol Biol Rev 2001;65:232–60. doi: 10.1128/MMBR.65.2.232-260.2001 2. Bryskier A, editor. Antimicrobial agents: Antibacterials and antifungals. Washington Dc, USA: ASM Press; 2005. 3. Agwuh KN, MacGowan A. Pharmacokinetics and pharmacodynamics of the tetracyclines including glycylcyclines. J Antimicrob Chemother 2006;58:256–65. doi: 10.1093/jac/ dkl224 4. Russo E, Lucatello L, Giovanardi D, Cagnardi P, Ortali G, Di Leva V, Montesissa C. Approved medication of water with enrofloxacin to treat turkey colibacillosis: assessment of efficacy using a PK/ PD approach. Vet Microbiol 2012;161:206–12. doi: 10.1016/j. vetmic.2012.07.028 5. Soliman AM, Aboubakr M, El-Hewaity M. Bioequivalence study of two oral doxycycline formulations (Doxysol® and Doxymed®) in healthy broiler chickens. Pharmacol Pharm 2015;6:1–8. 6. Marx JO, Vudathala D, Murphy L, Rankin S, Hankenson FC. Antibiotic administration in the drinking water of mice. J Am Assoc Lab Anim Sci 2014;53:301–6. 7. Zakeri B, Wright GD. Chemical biology of tetracycline antibiotics. Biochem Cell Biol 2008;86:124–36. doi: 10.1139/O08-002
11
8. Flammer K, Massey JG, Meek CJ, Papich MG. Assessment of plasma concentrations and potential adverse effects of doxycycline in cockatiels (Nymphicus hollandicus) fed a medicated pellet diet. J Avian Med Surg 2013;27:187–93. doi: 10.1647/1082-674227.3.187 9. Hu GZ, Pan YS, Wu H, Hu H, Xu R, Yuan L, Liu JH, Feng JK. Prevalence of tetracycline resistance genes and identification of tet (M) in clinical isolates of Escherichia coli from sick ducks in China. J Med Microbiol 2013;62:851–8. doi: 10.1099/ jmm.0.051896-0
10. Warburton PJ, Ciric L, Lerner A, Seville LA, Roberts AP, Mullany P, Allan E. TetAB46, a predicted heterodimeric ABC transporter conferring tetracycline resistance in Streptococcus australis isolated from the oral cavity. J Antimicrob Chemother 2013;68:17–22. doi: 10.1093/jac/dks351 11. Videnska P, Faldynova M, Juricova H, Babak V, Sisak F, Havlickova H, Rychlik I. Chicken faecal microbiota and disturbances induced by single or repeated therapy with tetracycline and streptomycin. BMC Vet Res 2013;9:30. doi: 10.1186/1746-6148-9-30
12. Garrido-Mesa N, Utrilla P, Comalada M, Zorrilla P, GarridoMesa J, Zarzuelo A, Rodríguez-Cabezas ME, Galvez J. The association of minocycline and the probiotic Escherichia coli Nissle 1917 results in an additive beneficial effect in a DSS model of reactivated colitis in mice. Biochem Pharmacol 2011;82:1891– 900. doi: 10.1016/j.bcp.2011.09.004
13. Kizerwetter-Swida M, Binek M. Selection of potentially probiotic Lactobacillus strains towards their inhibitory activity against poultry enteropathogenic bacteria. Pol J Microbiol 2005;54:287–94. 14. Shokryazdan P, Sieo CC, Kalavathy R, Liang JB, Alitheen NB, Faseleh Jahromi M, Ho YW. Probiotic potential of Lactobacillus strains with antimicrobial activity against some human pathogenic strains. Biomed Res Int 2014;2014:927268. doi: 10.1155/2014/927268 15. Lutful Kabir SM. The role of probiotics in the poultry industry. Int J Mol Sci 2009;10:3531–46. doi: 10.3390/ijms10083531
16. Peng Q, Zeng XF, Zhu JL, Wang S, Liu XT, Hou CL, Thacker PA, Qiao SY. Effects of dietary Lactobacillus plantarum B1 on growth performance, intestinal microbiota, and short chain fatty acid profiles in broiler chickens. Poult Sci 2016;95:893–900. doi: 10.3382/ps/pev435
17. Hooper LV, Wong MH, Thelin A, Hansson L, Falk PG, Gordon JI. Molecular analysis of commensal host-microbial relationships in the intestine. Science 2001;291:881–4. DOI: 10.1126/ science.291.5505.881
18. Dicks LMT, Botes M. Probiotic lactic acid bacteria in the gastrointestinal tract: health benefits, safety and mode of action. Benef Microbes 2010;1:11–29. doi: 10.3920/BM2009.0012 19. Nielsen DS, Cho GS, Hanak A, Huch M, Franz CM, Arneborg N. The effect of bacteriocin-producing Lactobacillus plantarum strains on the intracellular pH of sessile and planktonic Listeria monocytogenes single cells. Int J Food Microbiol 2010;141:S53– 9. doi: 10.1016/j.ijfoodmicro.2010.03.040
20. Perumal V, Repally A, Dasari A, Venkatesan A. Partial purification and characterization of bacteriocin produced by Enterococcus faecalis DU10 and its probiotic attributes. Prep Biochem Biotechnol 2016;46:686–94. doi: 10.1080/10826068.2015.1135451 21. Abreu MT. Toll-like receptor signalling in the intestinal epithelium: how bacterial recognition shapes intestinal function. Nat Rev Immunol 2010;10:131–44. doi: 10.1038/nri2707
12 22. Townes CL, Michailidis G, Nile CJ, Hall J. Induction of cationic chicken liver-expressed antimicrobial peptide 2 in response to Salmonella enterica infection. Infect Immun 2004;72:6987–93. doi: 10.1128/IAI.72.12.6987-6993.2004
23. Townes CL, Michailidis G, Hall J. The interaction of the antimicrobial peptide cLEAP-2 and bacterial membrane. Biochem Biophys Res Commun 2009;387:500–3. doi: 10.1016/j. bbrc.2009.07.046
24. Gilbert ER, Li H, Emmerson DA, Webb KE Jr, Wong EA. Dietary protein composition influences abundance of peptide and amino acid transporter messenger ribonucleic acid in the small intestine of 2 lines of broiler chicks. Poult Sci 2010;89:1663–76. doi: 10.3382/ps.2010-00801
25. Guo S, Liu D, Zhao X, Li C, Guo Y. Xylanase supplementation of a wheat-based diet improved nutrient digestion and mRNA expression of intestinal nutrient transporters in broiler chickens infected with Clostridium perfringens. Poult Sci 2014;93:94– 103. doi: 10.3382/ps.2013-03188 26. Danova S, Tropcheva R, Ivanovska N, Georgieva R, DobrevaYosifova G, Petrova M, Koleva P, Dermendvjieva J, Dimitonova S. Characterisation of Bulgarian lactobacilli as probiotics. In: Gulubov A, editor. Jubilee book: New trends in microbiology, 65th Anniversary of the Stephan Angeloff Institute of Microbiology. Sofia: 2012. p.177–92. 27. Anonymous Joint FAO/WHO Working Group Report on Drafting Guidelines for the Evaluation of Probiotics in Food. London, Ontario, Canada: April 30 and May 1, 2002. Guidelines for the Evaluation of Probiotics in Food. Available from: http://www.who.int/foodsafety/fs_management/en/probiotic_ guidelines.pdf
28. Tropcheva R, Hristova J, Georgieva R, Salageanu A, Sgouras DN, Danova S. In vitro assessment of prebiotic utilization by dairy lactobacilli. Bulg J Agricult Sci 2013;19:105–7.
29. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 2002;3(7):RESEARCH0034. 30. Angelakis E, Million M, Kankoe S, Lagier JC, Armougom F, Giorgi R, Raoult D. Abnormal weight gain and gut microbiota modifications are side effects of long-term doxycycline and hydroxychloroquine treatment. Antimicrob Agents Chemother 2014;58:3342–7. doi: 10.1128/AAC.02437-14
31. Chen HQ, Yang J, Zhang M, Zhou YK, Shen TY, Chu ZX, Zhang M, Hang XM, Jiang YQ, Qin HL. Lactobacillus plantarum ameliorates colonic epithelial barrier dysfunction by modulating the apical junctional complex and Pept1 in IL-10 knockout mice. Am J Physiol Gastrointest Liver Physiol 2010;299:G1287–97. doi: 10.1152/ajpgi.00196.2010
32. Sun X, Zhang H, Sheikhahmadi A, Wang Y, Jiao H, Lin H, Song Z. Effects of heat stress on the gene expression of nutrient transporters in the jejunum of broiler chickens (Gallus gallus domesticus). Int J Biometeorol 2014;59:127–35. doi: 10.1007/ s00484-014-0829-1
Turk J Immunol 2017; 5(1):5–12
33. Gilbert E, Li H, Emmerson D, Webb KE Jr, Wong EA. Developmental regulation of nutrient transporter and enzyme mRNA abundance in the small intestine of broilers. Poult Sci 2007;86:1739–53.
34. Rubio-Aliaga I, Daniel H. Peptide transporters and their roles in physiological processes and drug disposition. Xenobiotica 2008;38:1022–42. doi: 10.1080/00498250701875254 35. Hu XF, Guo YM, Huang BY, Bun S, Zhang LB, Li JH, Liu D, Long FY, Yang X, Jiao P. The effect of glucagon-like peptide 2 injection on performance, small intestinal morphology, and nutrient transporter expression of stressed broiler chickens. Poult Sci 2010;89:1967–74. doi: 10.3382/ps.2009-00547 36. Inoue M, Terada T, Okuda M, Inui KI. Regulation of human peptide transporter 1 (PEPT1) in gastric cancer cells by anticancer drugs. Cancer Lett 2005;230:72–80. doi: 10.1016/j. canlet.2004.12.023
37. Madsen S L, Wong EA. Expression of the chicken peptide transporter 1 and the peroxisome proliferator-activated receptor α following feed restriction and subsequent refeeding. Poult Sci 2011;90:2295–300. doi: 10.3382/ps.2010-01173 38. Otter M, Oswald S, Siegmund W, Keiser M. Effects of frequently used pharmaceutical excipients on the organic cation transporters 1-3 and peptide transporters 1/2 stably expressed in MDCKII cells. Eur J Pharm Biopharm 2017;112:187–95. doi: 10.1016/j. ejpb.2016.11.028
39. Su S, Miska KB, Fetterer RH, Jenkins MC, Wong EA. Expression of digestive enzymes and nutrient transporters in Eimeria acervulinachallenged layers and broilers. Poult Sci 2014;93:1217–26. doi: 10.3382/ps.2013-03807 40. Michailidis G. Expression of chicken LEAP-2 in the reproductive organs and embryos and in response to Salmonella enterica infection. Vet Res Commun 2010;34:459–71. doi: 10.1007/ s11259-010-9420-3
41. Milanova A, Santos R, Lashev L, Koinarski V, Fink-Gremmels J. Influence of experimentally induced Eimeria tenella infection on gene expression of some host response factors in chickens. Bulg J Vet Med 2015;19:47–56. doi: 10.15547/bjvm.896 42. Shao Y, Wang Z, Tian X, Guo Y, Zhang H. Yeast β-d-glucans induced antimicrobial peptide expressions against Salmonella infection in broiler chickens. Int J Biol Macromol 2016;85:573– 84. doi: 10.1016/j.ijbiomac.2016.01.031
43. Akbari MR, Haghighi HR, Chambers JR, Brisbin J, Read LR, Sharif S. Expression of antimicrobial peptides in cecal tonsils of chickens treated with probiotics and infected with Salmonella enterica serovar Typhimurium. Clin Vaccine Immunol 2008;15:1689–93. doi: 10.1128/CVI.00242-08
44. Garrido-Mesa J, Algieri F, Rodriguez-Nogales A, Utrilla M, Rodriguez-Cabezas M, Zarzuelo A, Ocete M, Garrido-Mesa N, Galvez J. A new therapeutic association to manage relapsing experimental colitis: doxycycline plus Saccharomyces boulardii. Pharmacol Res 2015;97:48–63. doi: 10.1016/j.phrs.2015.04.005
ORIGINAL ARTICLE / ÖZGÜN MAKALE
Turkish Journal of Immunology - Open Access www.turkishimmunology.org Turk J Immunol 2017; 5(1):13−19
Immunomodulatory Effect of Propolis Extract on Granzyme Expression in CD8+ and CD4+CD25+ T Cells Propolis Ekstresinin CD8+ ve CD4+CD25+ T Hücrelerindeki Granzim İfadesi Üzerine Olan Bağışıklık Düzenleyici Etkileri Zauhani Kusnul1, Pudji Rahayu3, Muhaimin Rifai4, Edi Widjajanto5
Abstract Objective: The purpose of this study was to explore the effect of propolis extract on CD8+ and CD4+CD25+ regulatory T cell populations and granzyme expression in both cell populations, as propolis has been suggested as an immunomodulatory agent. Materials and Methods: PBMC containing 1x106 cells/ml from cervical cancer stage 3 patients were isolated and cultured with and without propolis extract. The cells were plated in a 24-well plate with RPMI medium supplemented with 10% FBS, 10 U/ml penicillin, 100 U/ml streptomycin, 2 mM L-glutamine and 50 μM 2-ME. Propolis extract was added (5, 10, 25 and 50 μg/ml) to PBMC culture. Negative control was made from PBMC culture without propolis extract for comparison. The cells were incubated for 48 hours in a 5% CO2 incubator at 37ºC. The proportion of CD8+ and CD4+CD25+ regulatory T cells that expressed granzyme were measured by flow cytometry. Results: The results obtained that the level of CD4+, CD4+CD25+, and CD8+ T cells were not markedly depleted in propolis treatment in all doses compared to control group. The percentage of CD8+Granzyme+ and CD4+CD25+Granzyme+ were significantly different in groups of propolis treatment compared to control group. Conclusion: In summary, propolis extract may serve as an immunomodulatory agent in cervical cancer patients. Propolis extract could modulate the expression CD4+CD25+ T cells expressing granzyme and CD8+ T cells expressing granzyme while it has no effect on CD4+, CD4+CD25+, and CD8+ T cells. Keywords: CD8+ T cells, CD4+CD25+ regulatory T cells, granzyme, propolis Bahrul Ulum Nursing Academy, Jombang, Indonesia, jombang, Indonesia 2 Faculty of Medicine, Brawijaya University, Malang, Indonesia , Malang, Indonesia 3 Saiful Anwar General Hospital, Faculty of Medicine, University of Brawijaya, Malang, Indonesia, Department of Ear, Nose, and Neck, Malang, Indonesia 4 Faculty of Sciences, University of Brawijaya, Malang, Indonesia, Department of Biology, Malang, Indonesia 5 Saiful Anwar General Hospital, Faculty of Medicine, University of Brawijaya, Malang, Indonesia, Department of Clinical Pathology, Malang, Indonesia 1
Correspondence: Zauhani Kusnul Diponegoro University, Dermatology, Kudus, Indonesia e-mail:
[email protected] Received: February 20, 2017 Accepted: May 09, 2017 doi: 10.25002/tji.2017.544 ©2017 Turkish Journal of Immunology. All rights reserved.
Öz Amaç: Çalışmanın amacı, propolis ekstresinin bağışıklık düzenleyici bir madde olarak CD8+ ve CD4+CD25+ düzenleyici T hücrelerindeki granzim ifadesi üzerine olan etkisini incelemektir. Gereçler ve Yöntemler: Evre 3 serviks kanserli hastalardan elde edilen 10(6) hücre/mL konsantrasyonundaki Periferik Mononükleer Kan Hücreleri(PMKH) izole edilerek propolis eklenen ve eklenmeyen kaplarda kültüre edildi. Hücreler, %10 FBS, 10 U/ml penisilin, 100 U/mL streptomisin, 2mM L-glutamin ve 50 mikroM 2-ME içeren 24 kuyulu kültür kaplarına paylaştırıldı. Bir PMKH popülasyonu Propolis uygulanmadan kontrol grubu olarak oluşturuldu. Hücreler %5 CO2 içeren kuluçka makinesinde(inkübatör) 48 saat kültüre edildi. Granzim ifade eden CD8+, CD4+CD25+ düzenleyici T lenfositleri akan hücre ölçer ile irdelendi. Bulgular: Propolis uygulanan CD4+, CD4+CD25+ ve CD8+ T lenfositlerinin sayıları anlamlı ölçüde azalmadı. CD8+Granzim+ ve CD4+CD25+Granzim+ hücrelerin sayıları, propolis uygulanan hastalarda farklı idi. Sonuç: Sonuç olarak, propolis ekstresi serviks kanserli hastalarda bağışıklığı değiştiren bir madde olarak etki etmektedir. Ekstre, CD4+CD25+ T lenfositleri ile CD8+ T lenfositlerinde granzim ifadesini değiştirmekte, ancak ekstrenin CD4+, CD+CD25+ ve CD8+ T lenfositlerinde granzim ifadesine etkisi görülmemektedir. Anahtar Kelimeler: CD8+ T Hücreleri, CD4+CD25+ düzenleyici T Hücreleri, granzim, propolis
Introduction It has been generally understood that the immune system has a major role in the formation of cancer cell and cancer cell growth. Physiologically, a human has a defense mechanism that works in an integrated manner to protect themselves from the invasion of a stranger and the development of cancer cells, this mechanism is known as immunosurveillance.[1] However, cancer cells make various efforts to escape
13
14 from immunosurveillance activity by manipulating the population and activity of various immune system components, affecting the population proportion of cells in the immune system, and stimulate the development of immune cells that are immunosuppressive so favorable for its development. One of the cells with the potential immunosuppression is regulatory T cells (CD4+CD25+Foxp3+).[2,3] Lymphocyte-mediated cytotoxicity is a major immune effector function required for normal defense against pathogens, control of neoplasms, and regulating immune responses. The role of cytotoxic T lymphocyte (CTL) in the immune response to a neoplasm has a very important position.[4] The most important way of CTL cytotoxic activity is via exocytosis of perforin and Granzyme. Granzyme is a subclass of serine proteases with diverse proteolytic specificities, while the main role of perforin is to permeabilize cell membrane to allow granzyme (the effector proteases), enter the target cells.[5] Granzyme is a major component of cytotoxic lymphocyte granules that trigger the apoptosis of target cells. The granzyme main role is to induce cell death to eliminate viruses and tumor cells.[6] The immune response physiologically requires regulators to prevent an excessive immune response. One type of immune cell that has immunosuppressive activity is the regulatory T cell.[2,3] Regulatory T cells are a subset of T cells that express CD4, CD25, and the transcription factor Foxp3, and normally induce tolerance. An increase in these cells may reduce the immune response and suppress defense against tumors by inhibiting cytokines. Regulatory T cell activation is induced by TGF-β and IL-2 and is associated with a poor prognosis in cases of malignancy.[7] Regulatory T cells affect many components of the immune system, including CD4+ T cells (Th1, Th2, and Th17), CD8+ T cells, macrophage, dendritic cells (DCs), natural killer cells (NK), NKT cells, mast cells, osteoblasts and B cells[8] and have the capacity to reduce and inhibit an effective immune response to cancer cells. Activated regulatory T cells suppress the innate and adaptive immune responses through different mechanisms, including upregulating the production of immunosuppressive cytokines such as IL-10 and TGF-β[9], inhibiting the maturation of APC, in this case DCs by inhibiting the expression of the costimulatory molecules CD80 and CD86[10], inducing T cell cytolysis by releasing perforin and granzyme that can kill CD4+ T cells, CD8+ T cells, DCs and monocytes[2],
Turk J Immunol 2017; 5(1):13–19
and interfering with the metabolism of T cell responders, as regulatory T cells contain high concentrations of cAMP, which can inhibit proliferation, differentiation, and synthesis of IL-2 in T cells.[11] Regulatory T cells are potent inhibitors of antitumor immunity and immunotherapy due to these immunosuppressive mechanisms.[12] Thus, regulatory T cells are an important target for cancer immunotherapy, as decreasing or inhibiting regulatory T cells is expected to improve the effectiveness of the immune response to cancer. Strategies inhibiting regulatory T cells target a variety of pathways, including the depletion of regulatory T cells in quantity and suppression/inhibition of their immunosuppressive function. Both CD8+ cytotoxic lymphocytes (CTL) and regulatory T cells express granzyme. For CTL, granzyme is an important effector molecule of cytotoxic activity against target cells, including cancer cells. Granzyme is expressed by regulatory T cells and triggers cytolysis of CD4+ T cells, CD8+ T cells, DCs and monocytes.[2,13] Propolis is a substance produced by bees from plant resins collected and combined with the wax and secretions from the salivary glands of bees are rich in various enzymes.[14,15] Bee Propolis is used to coat the walls of the nest to protect the animals from the entry of the attacker from the outside, inhibit bacterial and fungal growth, strengthen cell walls also maintain an aseptic environment in a nest.[16] Propolis is a natural product with known immunomodulatory activity, but how it affects CTL and regulatory T cells is still unknown. This is a preliminary study to examine the effect of propolis extract on regulatory T cell (CD4+CD25+) and CTL (CD8+) population and to assess the expression of granzyme in cultured PBMC obtained from of cervical cancer stage 3 patients.
Materials and Methods Propolis extraction The propolis extraction process was performed based on a modified method.[17] One hundred grams of propolis was cut into small pieces and frozen at -80 °C. After that, propolis was ground and extracted with ethanol (1:10). The solution was sonicated using an ultrasonic bath at 25 °C for 30 minutes in the dark. After sonication, the solution was filtered through Whatman No.1 filter paper. Sonication using 70% ethanol was repeated in order to
Kusnul et al. n Immunomodulatory Effect of Propolis Extract on Granzyme Expression in CD8+ and CD4+CD25+ T Cells
obtain the active compounds. The total solution then kept in the refrigerator for wax removal overnight. The solution was filtered through Whatman No.1 filter paper and evaporated to remove the organic solvent.
PBMC Isolation The samples used in this study were obtained from the blood of cervical cancer stage 3 patients who previously diagnosed by oncologists of Saiful Anwar General Hospital, Malang Indonesia. The authors did not do the clinical characterization of the patients. All patients were new cases who had received no prior treatment, chemotherapy and/or radiation therapy before sample collection. Informed consent was obtained from all subjects before sample collection. From each patient, 5 ml of peripheral blood was obtained using a 5-ml EDTA-containing syringe and kept in a Vacutainer with sodium heparin (BD, USA). The blood samples were mixed with the same volume of PBS. The diluted blood sample was layered on Ficoll-Paque Plus using a Pasteur pipette. The mixture was centrifuged at 4000x g for 40 minutes at 18-20 ºC. After centrifugation, the lymphocyte layer was transferred to a new tube and washed twice with PBS. The cell pellet was resuspended with Roswell Park Memorial Institute (RPMI)-1640 medium with 10% fetal bovine serum (FBS).
PBMC Culture PBMC contained 1x106 cells/ml were plated in a 24well plate with RPMI medium supplemented with 10% FBS, 10 U/ml penicillin, 100 U/ml streptomycin, 2 mM L-glutamine and 50 μM 2-ME. Propolis extract was added (5, 10, 25 and 50 μg/ml) to the PBMC cultures. Negative control was made from PBMC culture without propolis extract for comparison. The cells were incubated for 48 hours in a 5% CO2 incubator at 37ºC. Flow cytometry Peripheral blood mononuclear cells were harvested for further flow cytometric analysis. To detect the percentage of CD4+CD25+granzyme+ lymphocytes, cells were incubated with 5 µl of anti-human CD4 FITC and antihuman CD25 PE monoclonal antibodies (Biolegend, USA) for 30 minutes at room temperature in the dark. The appropriate isotype control antibodies (all from Biolegend) were simultaneously added to a separate tube containing cells from the same patient and incubated for 30 minutes in the dark. After centrifugation and washing with the
15
washing solution, the samples were fixed using 300 µl of 1% paraformaldehyde and permeabilized using the same amount of 0.1% saponin (Sigma-Germany). Anti-human granzyme AlexaFluor 647 (Bios) was then added to the permeabilized cells and incubated for 30 minutes in the dark. The appropriate isotype control was simultaneously used in the control tube with permeabilized cells. To detect the percentage of CD8+granzyme+ cells that express granzyme, the same procedure was done as above using anti-human CD8+ FITC (Biolegend) and anti-human granzyme AlexaFluor 647 (Bios). After the final fixation, samples were analyzed immediately by using a BD FACS Calibur flow cytometer (BD, USA). Cellquest-pro software (BD-USA) was used for data acquisition and analysis. Briefly, the percentage of total CD4+ T cells was first calculated in the lymphocyte gate. In order to define the percentages of CD25+ regulatory T cells among the lymphocyte population, the lymphocyte gate was applied on the quadrant of the CD4/FSC dot plot. The CD4 positive lymphocyte gate was finally applied on the CD25+/granzyme+ histogram and the percentage of CD4+CD25+granzyme+ lymphocytes was considered as the percentage of regulatory T cells that expresses granzyme.
Statistical analysis One-way ANOVA was used to analyze the data. The differences between groups were considered significant at p<0.05. All results were presented as the mean of ± SD values of 10 samples with three replicates in each group. Statistical analysis was performed by using SPSS software. This was followed by a posthoc Tukey’s honestly significant difference (HSD) test to determine major changes and differences among CD8+ and CD4+CD25+ regulatory T cells and also the proportion of CD8+ and CD4+CD25+ T cells that expressed granzyme relative to the density mean values.
Results The results show that the percentage of CD4+, CD4+CD25+, and CD8+ T cells were not markedly decreased in all doses of propolis extract compared to control group (Fig. 1 and Fig. 2). In addition to observing changes in the CD4+CD25+and CD8+ T cell populations, we observed the further study of their functional activity. In this case, we assessed
16
Turk J Immunol 2017; 5(1):13–19
Figure 2. Propolis extract is not significantly changed the percentage of CD4+, CD4+CD25+, and CD8+ T cells population. The bars are the calculation of the number of CD4+, CD4+CD25+ and CD8+ T cells on PBMC from cervical cancer stage 3patients in vitro. PBMC from patients with stage 3 cervical cancer were treated as indicated for 48 hours and the expression of CD4+, CD4+CD25+ and CD8+ T cells were detected by flow cytometry. The differences between groups were considered significant at p<0.05. All results were presented as the mean ± SD values of 10 samples in each group with 3 replications. Figure 1. Propolis extract is not able to increase the level of CD4+CD25+ in all doses compared to control group. The relative number of CD4+CD25+ cells PBMC after 48 hours of propolis treatment and analyzed by flow cytometry (D0= PBMC culture without propolis extract/Control, D1 = PBMC culture with 5 μg/ml propolis extract, D2 = PBMC culture with 10 μg/ml propolis extract and D3 = PBMC culture with 25 μg/ml propolis extract, D4= PBMC culture with 50 μg/ ml propolis extract). Data are mean of ± SD values 10 samples with three replications.
p-value 0.044 and 0.019 respectively. The relative number of CD4+CD25+ expressing granzyme in D3 and D4 group also have a significant difference compared with control group with p-value 0.003 and 0.000 respectively.
Discussion the expression of granzyme by CD8 T cells and CD4+CD25+ regulatory T cells. In this study, D1 and D2 group of propolis extract did not significantly increase the percentage of CD8+ T cells-expressing granzyme compared with the D0/control group. However, the level of CD8+ T cells-expressing granzyme in D3 and D4 group of propolis extract were markedly depleted (Fig. 3). Otherwise, propolis extract was able to markedly increased the expression of granzyme between control and propolistreated CD4+CD25+ regulatory T cells in D3 and D4 group (Fig. 4). +
One-way ANOVA with LSD Post-Hoc test showed that D3 group (PBMC culture with 25 μg/ml propolis extract) and D4 (PBMC culture with 50 μg/ml propolis extract) have a significant difference of the relative number of CD8+ expressing granzyme compared with control with
The effect of propolis extract to the population of CD8+ and CD4+CD25+ regulatory T cells In this study there was no significant change in the percentage of CD4+ T-cell populations, CD4+ CD25+ and CD8+, these results are different from a study by Rohmawati who reported that 200 mg/kgBW propolis extract given to normal mice increased the activation of CD4+T cells (CD4+ CD62L-) and decrease the level of CD8+ 62L-T cells.[18] Different results were also obtained by Rifai (2014) who found that propolis extracts increased the number of CD4+ CD25+ T cells in normal mice but caused a decrease in diabetic model rats. These facts suggest that propolis extract can maintain immunological homeostasis so that propolis extract causes different effects when administered under different conditions.
Kusnul et al. n Immunomodulatory Effect of Propolis Extract on Granzyme Expression in CD8+ and CD4+CD25+ T Cells
17
Figure 3. Propolis extract in D3 and D4 group is able to increase the level of CD8+ T cells-expressing granzyme compared to control (D0) group. The relative number of CD8+ cells-expressing granzyme after 48 hours of propolis treatment and analyzed by flow cytometry (D0 = PBMC culture without propolis extract/Control, D1 = PBMC culture with 5 μg/ml propolis extract, D2 = PBMC culture with 10 μg/ ml propolis extract and D3 = PBMC culture with 25 μg/ml propolis extract, D4 = PBMC culture with 50 μg/ml propolis extract. Data are mean of ± SD values of 10 samples with 3 replications.
Figure 4. Propolis extract in D3 and D4 group is able to decrease the CD4+CD25+ T cells-expressing granzyme compared to control (D0) group. The relative number of CD4+CD25+ Granzyme+ after 48 hours of propolis treatment and analyzed by flow cytometry (D0 = PBMC culture without propolis extract, D1 = PBMC culture with 5 μg/ml propolis extract, D2 = PBMC culture with 10 μg/ml propolis extract and D3 = PBMC culture with 25 μg/ml propolis extract, D4= PBMC culture with 50 μg/ml propolis extract). Data are mean ± SD values of 10 samples with 3 replications.
The therapeutic effect of propolis extract was probably derived from its active compounds, one of which is caffeic acid phenethyl ester (CAPE).[19] CAPE has been widely studied and has been shown to possess antioxidant,[20,21] anti-cancer[22–26], as well as immunomodulatory[27,28] capacity. As an immunomodulator, CAPE has been shown to inhibit the percentage of PBMC expressing CD25 following stimulation with staphylococcal enterotoxin B.[28] CAPE also lowered the expression of several cytokines, such as IL-12, IL-10 and IL-4, in cultured PBMC and T cells from a healthy donor after stimulation with pokeweed mitogen.[27]
(CD4+CD25+ regulatory T cells) affect many components of the immune system, including CD4+ T cells (Th1, Th2, and Th17), CD8+ T cells, macrophages, DCs, NK cells, NKT cells, mast cells, osteoblasts, and B cells.[8] Regulatory T cells also have a functional activity to suppress the activity of CD8+ T cells.[29] Via a variety of immunosuppressive mechanisms, regulatory T cells are potent inhibitors of anti-tumor immunity and immunotherapy. Decreasing or inhibiting effect of regulatory T cells is expected to improve the effectiveness of the immune response to destroy cancer cells.
In the context of tumor immunology, the cell population changes after the administration of propolis extract have a positive meaning and benefit. Regulatory T cells
Several studies had reported the effectiveness of using monoclonal antibodies to deplete regulatory T cells, including the anti-CD25 monoclonal antibody PC61, which was reported to cause the depletion of regulatory T
18
Turk J Immunol 2017; 5(1):13–19
cells, including cancer cells. Granzymes in the past were thought to be expressed only by NK cells and cytotoxic T cells, which could be either CD8+ T cells or cytolytic CD4+ T cells, usually of the Th1 lineage.[6]
Figure 5. Effect of propolis extract to the percentage of the CD8+ and CD4CD25+ regulatory T cells-expressing granzyme. PBMC were treated as indicated for 48 hours and the expression of CD8+granzyme+ and CD4+CD25+granzyme+ were detected by flow cytometry as described under Material and Methods. The differences between groups were considered significant at p<0.05. All results were presented as the mean ± SD values of 10 samples with three replicates in each group.
Granzyme is expressed in regulatory T cells and plays an important perforin-dependent role in regulatory T cell function in mice.[6] Granzyme which expressed by regulatory T cells could be used to perform immunosuppressive functions (i.e. to inhibit CD8+ T cells). The ability of regulatory T cells to regulate antigenspecific CD8+ T cell responses is mediated in part by granzyme, whether granzyme is required for regulatory T cells to suppress CD8+ T cell proliferation in vitro. Wildtype regulatory T cells are able to efficiently suppress CD8+ T proliferation in a dose-dependent manner, whereas granzyme negative regulatory T cells display less suppression of CD8+ T cell proliferation.[2]
cells and inhibit the formation of tumors in experimental animals with mucin-like carcinoma associated antigen fibrosarcoma.[30] Moreover, the depletion of regulatory T cells in experimental animals increases the effectiveness of vaccination and HPV DNA to stimulate CD8+ T cells specific for E7.[31] The anti-CD25 monoclonal antibody has also been used as a cancer immunotherapy, i.e. daclizumab. Provision of daclizumab in patients with metastatic breast cancer causes a decrease in CD25+FoxP3+ regulatory T cells in the peripheral blood. The result showed effective results in promoting the activity of cytotoxic T cells.[32]
In conclusion, our results show that the increased level of CD8+ T cells-expressing granzyme and a decreased level in CD4+CD25+ T cells-expressing granzyme by D3 and D4 propolis extract were both provide positive benefits in cancer therapy. Further research is needed to study whether propolis extract results in changes in cell populations and if the expression of granzyme can increase cancer cell death.
In addition to a variety of beneficial effects, regulatory T cell depletion with anti-CD25 antibodies also has some disadvantages: the anti-CD25 monoclonal antibody is less effective against regulatory T-cells that do not express CD25 or when CD25 is expressed at low levels, and effector T cells that express CD25 can also be depleted. In addition, the depletion of regulatory T cells has also been reported to increase the concentration of circulating IgM autoantibodies.[30]
DECLARATION OF CONFLICT INTEREST
Effect of propolis extract on the expression of granzyme by CD8+ T cells and CD4+CD25+ regulatory T cells The mechanism of propolis due to these effects on granzyme expression in CD8+ and CD4+CD25+ regulatory T cells is still unclear, but the result of this study was very interesting and suggested the possibility of more favorable effects in cancer therapy. Granzyme is a cytolytic enzyme produced cytotoxic T cells that play a role in lysing target
ACKNOWLEDGEMENTS Authors would like to thank Faculty of Medicine, Brawijaya University, Saiful Anwar General Hospital, Malang Indonesia and Departement of Biology Faculty of Sciences for facilitating this research. Special thanks to the chairman of the doctoral supervisor and team.
The authors declared no conflict of interest with respect to the authorship and/or publication of this article.
FUNDING We would like to thank Directorate General of Higher Education, Ministry technology research and higher education of Republic Indonesia for providing research grant.
References 1. Syal K, Banerjee D. Theories of Immunosurveillance/ Immunoevasion: An attempt to explain Persistence of Cancer. IOSR Journal of Pharmacy 2012;2:74–5.
2. Salti SM, Hammelev EM, Grewal JL, Reddy ST, Zemple SJ, Grossman WJ, Verbsky JW. Granzyme B Regulates Antiviral CD8 + T Cell Responses. J Immunol 2011;187(12):6301–9. doi: 10.4049/jimmunol.1100891
3. Ye J, Huang X, Hsueh EC, Zhang Q, Ma C, Zhang Y, Varvares MA, Hoft DF, Peng G. Human regulatory T cells induce T-lymphocyte senescence. Blood 2012;120:2021–31. doi: 10.1182/blood-2012-03-416040
Kusnul et al. n Immunomodulatory Effect of Propolis Extract on Granzyme Expression in CD8+ and CD4+CD25+ T Cells
4. Karimi S, Chattopadhyay S, Chakraborty NG. Manipulation of regulatory T cells and antigen-specific cytotoxic T lymphocytebased tumor immunotherapy. Immunology 2015;144:186–96. doi: 10.1111/imm.12387 5. Packard BZ, Telford WG, Komoriya A, Henkart PA. Granzyme B activity in target cells detects an attack by cytotoxic lymphocytes. J Immunol 2007;179:3812–20.
6. Chowdhury D, Lieberman J. Death by a Thousand cuts: granzyme pathways of programmed cell death. Annu Rev Immunol 2008;26:389–420. doi: 10.1146/annurev. immunol.26.021607.090404 7. Connolly EC, Freimuth J, Akhurst RJ. complexities of tgf-β targeted cancer therapy. Int J Biol Sci 2012;8(7):964–78. doi: 10.7150/ijbs.4564
8. Shevach EM, Tran DQ, Davidson TS, Andersson J. The critical contribution of TGF-beta to the induction of Foxp3 expression and regulatory T cell function. Eur J Immunol 2008;38:915–7. doi: 10.1002/eji.200738111 9. Dardalon V, Awasthi A, Kwon H, Galileos G, Gao W, Sobel R, et al. IL-4 inhibits TGF-beta-induced Foxp3+ T cells and, together with TGF-beta, generates IL-9+ IL-10+ Foxp3(-) effector T cells. Nat Immunol 2008;9:1347–55. doi: 10.1038/ni.1677
10. Onishi Y, Fehervari Z, Yamaguchi T, Sakaguchi S. Foxp3+ natural regulatory T cells preferentially form aggregates on dendritic cells in vitro and actively inhibit their maturation. Proc Natl Acad Sci U S A 2008;105:10113–8. doi: 10.1073/pnas.0711106105 11. Bodor J, Feigenbaum L, Bodorova J, Bare C, Reitz MS Jr, Gress RE. Suppression of T-cell responsiveness by inducible cAMP early repressor (ICER). J Leukoc Biol 2001;69:1053–9. 12. Zou W. Regulatory T cells, tumor immunity and immunotherapy. Nat Rev Immunol 2006;6:295–307. doi: 10.1038/nri1806
13. Grossman WJ, Verbsky JW, Barchet W, Colonna M, Atkinson JP, Ley TJ. Human T regulatory cells can use the perforin pathway to cause autologous target cell death. Immunity 2004;21:589–601. doi: 10.1016/j.immuni.2004.09.002 14. Pietta PG, Gardana C, Pietta AM. Analytical methods for quality control of propolis. Fitoterapia 2002;73 Suppl 1:S7–20.
15. Sawaya AC, Barbosa da Silva Cunha I, Marcucci MC. Analytical methods applied to diverse types of Brazilian propolis. Chem Cent J 2011;5:27. doi: 10.1186/1752-153X-5-27
16. Salatino A, Teixeira EW, Negri G, Message D. Origin and Chemical Variation of Brazilian Propolis. Evid Based Complement Alternat Med 2005;2:33–8. doi: 10.1093/ecam/neh060 17. Khacha-ananda S, Tragoolpua K, Chantawannakul P, Tragoolpua Y. Antioxidant and anti-cancer cell proliferation activity of propolis extracts from two extraction methods. Asian Pac J Cancer Prev 2013;14:6991–5.
18. Rohmawati E, Rifa’i M. Ethanol extracts of propolis (EEP) against lymphocyte activation cells in healthy mice (Mus Musculus) BALB/C. Jurnal Biotropika 2014;2:203–7. 19. Kusnul Z, Puspita E, Azizah U, Kaliawan, Rifai M, Widjajanto E. Identification and Quantification of Propolis’s Active Compound in Various Solvents. J Appl Environ Biol Sci 2016;6:94–9.
20. Akyol S, Ugurcu V, Altuntas A, Hasgul R, Cakmak O, Akyol O. Caffeic acid phenethyl ester as a protective agent against nephrotoxicity and/or oxidative kidney damage: a detailed systematic review. ScientificWorldJournal 2014;2014:561971. doi: 10.1155/2014/561971
19
21. Ozkan U, Osun A, Basarslan K, Senol S, Kaplan I, Alp H. Effects of intralipid and caffeic acid phenethyl ester on neurotoxicity, oxidative stress, and acetylcholinesterase activity in acute chlorpyriphos intoxication. Int J Clin Exp Med 2014;7:837–46. 22. Chiang EI, Tsai S, Kuo Y, Pai M, Chiu H, Rodriguez RL, Tang F. Caffeic Acid Derivatives Inhibit the Growth of Colon Cancer: Involvement of the PI3-K/Akt and AMPK Signaling Pathways. PLOS One 2014. doi: 10.1371/journal.pone.0099631 23. Hadiyah ZK, Widyarti S, Widodo MA. Local Propolis Extract Has Cytotoxic and Antiproliferative Effect On HeLa Cells. Jurnal Kedokteran Brawijaya 2009;25:17–22. 24. Hsu TH, Chu CC, Hung MW, Lee HJ, Hsu HJ, Chang TC. Caffeic acid phenethyl ester induces E2F-1-mediated growth inhibition and cell-cycle arrest in human cervical cancer cells. FEBS J 2013;280:2581–93. doi: 10.1111/febs.12242
25. Tseng TH, Shen CH, Huang WS, Chen CN, Liang WH, Lin TH, Kuo HC. Activation of neutral-sphingomyelinase, MAPKs, and p75 NTR-mediating caffeic acid phenethyl ester-induced apoptosis in C6 glioma cells. J Biomed Sci 2014;21:61. doi: 10.1186/1423-0127-21-61
26. Ulasli SS, Celik S, Gunay E, Ozdemir M, Ozyurek A, Koyuncu T, Unlu M. Anticancer effects of thymoquinone, caffeic acid phenethyl ester, and resveratrol on a549 non-small cell lung cancer cells exposed to benzo(a)pyrene. Asian Pac J Cancer Prev 2013;14:6159–64. 27. Ansorge S, Reinhold D, Lendeckel U. Propolis and some of its constituents down-regulate DNA synthesis and inflammatory cytokine production but induce TGF-beta1 production of human immune cells. Z Naturforch C 2003;58:580–9.
28. Marquez N, Sancho R, Macho A, Calzado MA, Fiebich BL, Muñoz E. Caffeic acid phenethyl ester inhibits T-Cell activation by targeting both nuclear factor of activated T-Cells and NF-B transcription factors. J Pharmacol Exp Ther 2004;308:993–1001. doi: 10.1124/jpet.103.060673 29. Ganesan AP, Johansson M, Ruffell B, Yagui-Beltran A, Lau J, Jablons DM, Coussens LM. Tumor-infiltrating regulatory T cells inhibit endogenous cytotoxic T Cell responses to lung adenocarcinoma. J Immunol 2013;191:2009–17. doi: 10.4049/ jimmunol.1301317 30. Betts G, Twohig J, Van Den Broek M, Sierro S, Godkin A, Gallimore A. The impact of regulatory T cells on carcinogeninduced sarcogenesis. Br J Cancer 2007;96:1849–54. doi: 10.1038/sj.bjc.6603824
31. Chuang CM, Hoory T, Monie A, Wang MC, Hung CF. Enhancing therapeutic HPV DNA vaccine potency through depletion of CD4+CD25+ T regulatory cells. Vaccine 2009;27:684–9. doi: 10.1016/j.vaccine.2008.11.042
32. Rech AJ, Vonderheide RH. Clinical use of anti-CD25 antibody daclizumab to enhance immune responses to tumor antigen vaccination by targeting regulatory T cells. Ann N Y Acad Sci 2009;1174:99–106. doi: 10.1111/j.1749-6632.2009.04939.x
ORIGINAL ARTICLE / ÖZGÜN MAKALE
Turkish Journal of Immunology - Open Access www.turkishimmunology.org Turk J Immunol 2017; 5(1)20−30
Molecular characterization of Amandin Molecular characterization of Amandin, an Allergen from Almond (Prunus dulcis) and the Effect of Heat and Enzymatic Treatments on Human IgE and Rabbit IgG Sensitivity to Almond Allergens Bademde (Prunus dulcis) Bulunan Bir Allerjen Olan Amandin’in Moleküler Olarak Tanımlanması ve Enzim Uygulaması ve Isının Badem Hassasiyeti ile Oluşan İnsan IgE’si ve Tavşan IgG’sine Olan Etkisi Ibtissam Ouahidi1,2, Chahid Ouaazizi2, Najlae Mejrhit2, Ouarda Azdad2, Lotfi Aarab2
Abstract Background: Several clinical studies have shown that the allergy to nuts has increased significantly in recent years. Almond allergy is one of the most significant allergies in several countries. For this reason, we were interested in studying almond sensitivity, and especially one of its allergens: amandin. Method: This work is based on a sample of sera from 252 patients. The samples were collected Ibn Elkhatib University Hospital Center and several private medical laboratories in Fez, Morocco. We also evaluated the sensitivity and immunoreactivity of human IgE and rabbit IgG to almonds variety of Prunus dulcis and investigated the effect of food processing (heat and/or enzymatic hydrolysis by pepsin) on this sensitivity. In addition molecular profile of amandin was studied. Results: Reported allergy revealed that 6.5% of patients had an allergy to egg, whereas 2.5, 0.4, 7.8, 3.9, 2.5 and 2.2% of patients were allergic to peanut, wheat flour, fish, strawberry, milk and almond respectively. The evaluation of specific IgE showed that the study population is sensitive to the species Prunus dulcis. The study of the variation of allergenicity of almond under the effect of the temperature and the enzymatic hydrolysis showed an important decrease for the recognition of proteins by human IgE. However, enzymatic hydrolysis modifies the same way the binding of human IgE to almond inducing a reduction of the allergenicity. The molecular characterization of the allergens indicated a major reactivity to Pru du 6 (amandin). This reactivity is highly reduced by treatments, especially the enzymatic one. Conclusion: Almond allergy could be reduced by heat treatment or enzymatic hydrolysis. Key words: Almond protein, specific IgE, thermal treatment, acid treatment, amandin High Institute of Nursing and Technical Health (ISPITS Fez), Ministry of Health, Fez, Morocco. 2 Laboratory of Bioactive Molecules (LMBSF), University Sidi Mohamed Ben Abdellah, Faculty of Sciences & Techniques, Fez, Morocco 1
Correspondence: Ibtissam OUAHIDI High Institute of Nursing and Technical Health, Al Ghassani Hospital, Fez, Morocco e-mail:
[email protected] Received: March 17, 2017 Accepted: May 16, 2017 doi: 10.25002/tji.2017.551 ©2017 Turkish Journal of Immunology. All rights reserved.
20
Öz Giriş:: Çalışmalar, fındığa karşı olan allerjinin son yıllarda arttığını göstermiştir. Bazı ülkelerde ise, en önemli allerji bademe karşı olan allerjidir. Bu nedenle, biz de bademe karşı olan, özellikle de içindeki allerjenlerden biri olan amandine karşı olan allerjiyi çalışmak istedik. Yöntem: Çalışma, 252 kişiden alınan kanların serumu ile yapıldı. Örnekler, Cezayir’in Fez şehrinde bulunan Ibn Elkhatib Üniversite Hastanesi ve bazı özel laboratuvarlardan alındı. Çalışmamızda ayrıca, çeşitli Prunus dulcis bademlerine karşı gelişen insan IgE’si ve tavşan IgG’sinin hassasiyetini, immün-etkileşimini ve bu etkileşime, yiyeceğe uygulanan ısıl ve/veya pepsin ile hidroliz işlemininin etkisini irdeledik. Ayrıca, amandinin moleküler özelliklerini çalıştık. Bulgular: Hastaların %6,5’inin yumurta allerjisine sahip olduğunu, bunların %2,5, %0,4, %7,8, %3,9, %2,5 ve %2,2’sinin sırasıyla yer fıstığı, buğday unu, balık, çilek, süt ve badem için alerjik olduğu saptandı. Özgün IgE’yi çalıştığımızda, toplumun Prunus dulcus çeşitlerine allerjisi olduğu saptandı. Bu allerjide, bademe karşı olan IgE’nin, ısıl ve enzimatik işlemler ile azaldığı bulundu. Bununla birlikte, enzimatik hidroliz de aynı şekilde insan IgE’sinin bademle bağlanmasını modifiye ederek allerjenikliğin azalmasına neden olmaktadır. Allerjenlerin moleküler tanımlaması ile ana etkileşimin Pru du 6’ya (amandin) olduğu görüldü. Bu proteine olan etkileşim, ürüne uygulanan işlemlerden özellikle enzim eklenmesi ile önemli ölçüde azaldı. Sonuç: Badem allerjisi, ısıl işlem ve enzim uygulanması ile oldukça azaltılabilir. Anahtar Kelimeler: Almond protein, özel IgE, termal ısı, asit tedavisi, amandin
21
Ouahidi et al. n Molecular characterization of Amandin
Introduction Food allergy affects as many as 6% of young children and 3–4% of adults.[1,2] During the past decade, concerns over avoidable mortality associated with allergic reactions to nuts has increased.[3,4] The most potent allergens of plant origin include legumes, nuts, and seeds. The proportion of selfreported allergy to peanuts and tree nuts was about 0.4% in adults.[5] A clear indication of the seriousness of tree nut allergies is the large percentage of fatal allergic reactions to foods for individuals over the age of six years.[4] There are four allergens of almond Prunus dulcis, Pru du 3 (Non-specific lipid transfer protein 1: nsLPT1; 9KDa), Pru du 4 (Profilin, 14 KDa), Pru du 5 (Acid ribosomal protein P2 60S; 10 KDa) and Pru du 6 (amandin, 11S globulin legumin-like protein; 360 KDa).[6] Frequency of nuts, in episodes of food-induced anaphylaxis varies. In France, for adults and children (n=60), an Almond allergy of 1.7% was reported[7]; in Great Britain, for adults and children (n=90), allergy to almond was 3.3%[8]; whereas the prevalences were 6.8, 2.3 for brazilian nut and hazelnut respectively in Spain[9]; almond allergy was reported to be 5.6% in people between 12 and 75 years old in United States.[10] Almond is known to contain as many as 188 different proteins[4,11] of which amandin is the major protein and constitutes up to 65% of the total soluble fraction.[12] Amandin has been identified as a major allergen.[13] The allergenicity of amandin, measured by the capacity to bind human IgE, has been demonstrated for multiple almond species and cultivars.[14] Amandin, is officially recognized as an allergen (Pru du 6) by the International Union of Immunological Societies-Allergen Nomenclature Subcommittee. Amandin is a hexamer and each monomer consists of two polypeptides: a 40–42 kDa acidic subunit and a 20–22 kDa basic subunit.[4,14,15] Various food processing techniques, described in the literatures such as heating, enzymatic digestion and pH, can influence the allergenic potential of food proteins. It can either increase or decrease the allergenicity of the food.[16–18] The epitopes can be described all along the allergenic molecule or basically situated in a specific area. By altering the protein by heating or by another treatment, its immunogenicity will change depending on whether the epitopes are sequential or conformational.
Conformational changes have been correlated with decreased immunogenicity. To this effect, our aim was to evaluate the allergy to Almond Protein (AP) of a large section of patients at the region of Fez in Morocco. We were interested to evaluate IgE-sensitivity to AP and its modulation by heat treatment or enzymatic digestion compared to specific rabbit IgG to native AP. This study was also concerned with molecular characterization of the allergenic profile of the patients, especially to amandin.
Patients and Methods 1. Chemicals The products used for this study were: • • •
Anti-IgE human sera conjugated to peroxidase, Sigma-Chemical (St Louis, Mo, USA); Bovine serum albumin (BSA), Sigma-Chemical; Orthophénylénediamine (OPD), Acrosorganics;
Other chemicals products were from Sigma or Merck.
2. Patients and Serum Collection A cross sectional study was conducted at the University Hospital Center (CHU) of Fez, Ibn Elkhatib Hospital and at several Medical Test Laboratories in Fez in order to collect serum samples. The collection of human sera was performed between January and May 2016, with the approval of the ethical committee of the CHU. The samples were randomly collected. It is important to note that the patients did not undergo any prior sensitivity to the AP, and that they came for various medical tests. With the consent of the patients, a blood sample was taken and put in a 3 ml dry tube without anti-coagulant. After collecting blood samples, centrifugation at 1252 g for 5 minutes allowed us to recover and separate the sera, which was then kept at -20°C until use. The chosen patients had not been sensitized to the AP, or challenged orally.
3. Preparation of Defatted Almond Flours and Treatment of the Almond Protein (AP) Almond was finely ground. The obtained powder or flour was defatted with chloroform and then dried before protein extraction which was achieved by suspending the sample in PBS (phosphate buffer solution pH 7.4) at 20% (w/v). The mixture was stirred for two hours, filtered and then centrifuged at 704 g, 4ºC for 15 min. The collected
22 supernatant, considered as native AP, was frozen at -20ºC until its utilization.[4,17,19] The native AP was then treated in four different ways as follows: - Heating at different temperatures (75, 85, and 100ºC) for 30, 60, 90 and 120 min, - Treatment in an acidic (pH 2) or basic (pH 11) medium for 30, 60, 90 and 120 min at 37ºC,[20] - Digesting by pepsin (hog stomach, 3354 U/mg) at a concentration of 50 μg/ml in an acidic environment (pH 2)[18] during 30 to 120 min at 37°C, - Processing by a combination of the two treatments (heating and enzymatic digestion).[20–22]
4. Amandin Purification The protocol described by Albillos[4] was followed and defatted almond flour was extracted at room temperature for 1 h using deionized distilled water containing 0.02% NaN3 (flour/H2 Oratio 1:50). The mixture was stirred using an orbital shaker with vortexing at 10 min intervals. After centrifugation (6000 g for 10 min), the residue was re-extracted once again in the same conditions. The supernatants were pooled and filtered through a filter. The clear filtrate was refrigerated (4C) overnight for 12–14 h, and the milky precipitate was recovered after centrifugation (12000 g for 20 min, at 4°C). The precipitate containing mostly amandin was then re-suspended in 0.01 M PBS (pH 7.4) and dialyzed against distilled water (24 h, 4 C, three changes), then frozen and stored at -20 C in airtight plastic bottles until required.[4]
5. Production of Polyclonal Antibodies Against the AP To study the immunoreactivity of antibodies to almond, IgG antibodies were prepared against native AP. These antibodies were obtained after the immunization of rabbits against the native AP using Freund adjuvant. The AP were injected subcutaneously at several points on the animal back in combination with complete Freund’s adjuvant for the first injection and with incomplete Freund’s adjuvant in subsequent immunizations at one week intervals. After one month, blood samples were collected in dry tubes. After centrifugation for 15 minutes at 704 g at 4ºC, sodium azide 0.02% was added to the sera and then frozen at -20ºC until use.[17,21,22]
Turk J Immunol 2017; 5(1):20–30
6. IgE Determinations Total IgE was evaluated by direct ELISA as described before.[21,23,24] Briefly, diluted human sera were placed in 96 micro-titration plate wells and incubated overnight at 4ºC. The non-specific sites were saturated with bovine serum albumin (BSA) 0.25% (200 μl/well). 100 μl of human anti-IgE peroxidase conjugate was then added and immune complex revealed after addition of 0.05% of orthophenylenediamine (OPD). Absorbance was measured at 490 nm by an ELISA reader (Labsystems Multiskan MS). To immobilize allergens, the proteins of the AP were diluted in a phosphate buffered saline (PBS) at the rate of 0.5 mg/ml and put in a volume of 100µl in each well. The plates were incubated at 4°C for one night. After washing, the plates can be conserved at -20°C until they are used. Human sera were added afterwards; the plate went through the same stages described for the dosage of total IgE. Quantification of IgE was made using IgE standards (10, 30, 70 and 90 IU/ml) as published before.[17,20,23,24] Positive and negative controls were included in each plate to check the specificity and sensitivity of each measure. The determination of specific Serum IgE was achieved without prior sensitization or provocation tests of the patients. The binding of rabbit IgG to the AP was determined by indirect ELISA in the same way as described for the determination of specific IgE. For each serum, determination of IgE was repeated at least in duplicate.
7. Size-exclusion Chromatography We achieved this chromatography to separate the AP. The protein extract was diluted to a concentration of 1 mg/ml in PBS buffer, pH 7.4 and submitted to a volume of 2 ml in a column filled with Sephadex gel G 100, then a titration was carried out in a number of 50 tubes of 2 ml. The reading is made in UV-visible spectrometer at 280 nm. 8. Polyacrylamide Gel Electrophoresis Protein profiling was carried out by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) analysis. The proteins of almonds were separated by 12% (w/v) polyacrylamide gel electrophoresis under denaturing conditions. The samples (5 mg/ml) of native or treated proteins were denatured by boiling samples for three minutes in the presence of SDS 10%, β-mercaptoethanol 0.8% (denaturing conditions). The migration was carried out in electrophoresis chamber, Hoefer scientific
23
Ouahidi et al. n Molecular characterization of Amandin
Table 1. Description of the studied population. Total
n
%
Average age (years)
Age interval (years)
15
6,2
14
05 -16
Men
83
33,3
31
16- 58
Women
152
60,5
36
15- 65
Children
instruments (San Francisco. California, USA), under a 25 mA current (consort EV243, Belgium) and the gel was stained with 0.1% Coomassie blue R250.[20,25]
9. Ethics This study was approved by the ethics committee of the University Hospital Centre of Fez. All experiments using animals have been conducted according to national and international laws.
10. Statistical Analysis
Table 2. Description of reported allergy among students at the Faculty in Fez (n =582) Total n=582
%
Women
55
Man
45
Age
Average age
25
Residence
Urban
92
Rural
8
Sex
Type of allergy
Statistics analysis was based on the student’s t-test taking p=0.05 as the limit of the significant value.
Results
Manifestations
Food allergy
30.9
Allergy to pollen
23.8
Drug allergy
1.9
Allergy to insect toxins
8.9
Other allergy
19
Digestive symptoms
21
1. Description of Sample
Cutaneous manifestation
252 adults including 152 women (60.3%), 83 men (33%) and 17 children (6.7%) were evaluated. The average age was 31 years for men, 36 for women and 14 for children. Ages ranged from 16 to 58 years in men and from 15 to 65 in women. The age of pediatric population ranged from 5 to 16 (Table 1). The determination of total human IgE was carried and resulted in a rate between 10 and 344 UI/ml.
Respiratory symptoms
29
Anaphylactic shock
2.2
2. Reported Allergy The questionnaire was completed by 582 students from different institutions of Fez (Faculty of Sciences and Technology, Faculty of Science Dhar EL Mehraz, Faculty of Letter Dhar EL Mehraz and High Institute of Nursing and Technical Health), among whom 45% were men and 55% were women, aged between 17 and 26 years. The total percentage of reported food allergy was 30.9%, which could be distributed as 7.8% to fish, 6.5% to eggs, 3.9% to peanut, 3.9% to strawberry, 2.5% to milk, 2% to nuts and 2.2% to almonds. Cutaneous manifestations represented 47.7%, while digestive and respiratory allergy were 21% and 29% respectively. Anaphylactic shock was reported in 2.2% of patients. (Table 2).
47.75
3. Measurement of specific Serum IgE A sample of 252 human sera was used to study the variation of the sensitivity to AP. In 24% of patients (n=62/252) anti-AP IgE was found be higher than 2 IU/mL. Among all patients 10.4% had a level between 20 and 80 IU/mL, 7.55% had between 80 and 120 IU/mL and whereas 5% had anti-AG IgE at a concentration between 120 and 200 IU/mL (Figure 1). The average titre was 42±2 IU/mL (n=62) ranging from 2.4 to 334.8 IU/mL. Of adults, men showed an average value of 17.6±1.3 IU/mL (n=21/99) with a maximum of 222.6 IU/mL, while women had an average value of 34.2±1.2 IU/mL (n=33/153) with a maximum value of 334 IU/mL. Women had a statistically higher concentration of IgE (p<0.05). Among children, only 2 cases were positive for specific IgE: a 5-year-old child with a specific IgE level of 76.9 IU/mL and a 10-year-old child with a 101 IU/mL level (others had negative values).
24
Turk J Immunol 2017; 5(1):20–30
objective was to identify the roles of temperature, pH, enzymatic hydrolysis with pepsin and the time sufficient to inhibit the reactivity of antibodies on the proteins of the AP. Figures 2 and 3 show the findings.
Figure 1. Distribution of specific IgE measured in patients in IU/ml.
4. Immunoreactive Rabbit IgG to Treated AP To study the effect of heat and enzymatic digestion of AP, two sets of experimentation were conducted. The first examined the effect of temperature and enzymatic treatment on the detection of the proteins of the AP by a rabbit polyclonal antibody prepared at the laboratory through repeated immunizations by the native AP. The
AP was heated at 70°C, 80°C, 90°C and 100°C at different time intervals varying from 30 min to 120 min. There was a decrease of polyclonal antibodies to AP at 30 min (Figure 2). The results showed a decrease of IgG binding to AP at all temperatures studied during the first 30 min of the treatment. At 100°C, the binding of polyclonal antibodies to these proteins was greatly diminished compared to the other two temperatures (70°C and 85°C). During the first 30 minutes, the binding of polyclonal antibodies to AP was reduced by 20% at 85°C of temperature and 40% at 100°C. After 120 min, the binding of IgG with AP was decreased by 33% for the proteins heated at 75°C and 85°C and 52% when protein heated at 100°C. Figure 2. Effect of heat treatment on the recognition of AP by rabbit IgG. The effect of temperature (75°C, 85°C and 100°C) was studied in 4 experiments using rabbit IgG anti-native AP. The binding of IgG was evaluated by ELISA as the response of IgG binding to AP, heated at different temperatures over time. Compared to control value (at t=0 min), all values are statistically significant as p<0.05. (n=4, *p<0.05, ** p<0.01, *** p<0.001).
Figure 3. Effect of pH and enzymatic hydrolysis on the recognition of AP by rabbit IgG. The effect of these treatments was studied using rabbit IgG anti-native AP. The binding of IgG was evaluated by ELISA for determining the response of IgG binding to AP hydrolyzed in alkali, acid or by pepsin at 37°C over time. Compared to control value (at t=0 min), all values are statistically significant. (N=3, *p<0.05, **p<0.01, ***p<0.001).
25
Ouahidi et al. n Molecular characterization of Amandin
Figure 3 demonstrates that the treatment of AP with pH 10–11 slightly increased the binding of rabbit IgG to AP during the first 60 min. IgG binding was decreased to the initial value after 90 min of treatment. The acidic pH decreased the binding of IgG to AP by 33% during 30 min. Pepsin hydrolysis in an acid environment greatly impaired the binding of IgG to AP which was reduced by 66% in the first 30 min of treatment. We observed a decrease of 91% of reactivity of the IgG after 120 min of treatment.
5. Human IgE Immunoreactivity to Treated AP In the second set of experiments, we studied the variation of the allergenicity of the AP by using human sera whereby the rates of specific IgE rates have been proved to be important. This immunoreactivity was studied with regard to temperature, enzymatic treatment in different pHs.
serum IgE to the proteins processed either at temperature 100°C during 30 min, or combination of heat treatment and pepsin digestion (Figure 4). We found that the IgE binding to heated proteins was slightly diminished compared to that which has developed to native proteins (Figure 4). Table 3 shows binding rates of anti-AP IgE to treated AP proteins. Recognition by IgE of the heated proteins decreased in 85% of patients. Among them, 61.9% showed a decrease less than 50%. Only one patient (5%) had increased binding. IgE binding was decreased to heated and hydrolyzed AP. This decrease was observed in 95% of patients; however, no patients showed an increase in IgE binding, whereas only 1 patient (5%) showed no change from the native proteins.
For this reason, we have selected 20 patients with high IgE. These serums were used to determine the reactivity of Figure 4. Effect of heating and enzymatic hydrolysis on the recognition of AP by human IgE. Absorbance represented percentage in relation to data obtained in control (Non treated AP). The control test was done by using native proteins. Values were obtained in the two different conditions, heating and combination of heating/pepsin hydrolysis treatments. In x-axis, numbers represent the laboratory identification number of patient’s sera.
Table 3. Ratio of variation of human IgE to AP treated by heating and combination of heating and enzymatic digestion
AP heated/ Native
AP heated and hydrolyzed/ Native
Patients with increased binding
Patients with decreased binding
Patients with unchanged binding
1
17
3
5.0
85.0
10.0
0
17
1
0
95.0
5.0
26 6. Immunoreactivity of Boiled and Roasted AP Raw foods underwent several transformations (heating, fermentation etc.) before they are distributed. Our goal was to compare the binding intensity of rabbit polyclonal antibodies to the proteins existing in various industrial products compared to the native proteins. The bindings of roasted and boiled almonds were studied. Mean titre of polyclonal antibodies to roasted almonds decreased 72% compared to that was measured for native almond. (Figure 5).
7. Molecular Characterization and Electrophoretic Analysis The size exclusion chromatography of almond (Prunus dulcis) is shown in Figure 6. In the protein extract precipitate, we were able to identify and separate the major allergen: the large molecule with a molecular weight of 360 kDa (amandin).
Turk J Immunol 2017; 5(1):20–30
We also carried out an SDS-PAGE electrophoresis of differently processed AP. The protein composition of various extracts of AP (native, heated and/or treated with pepsin) was compared by polyacrylamide gel electrophoresis under denaturing conditions (Figure 7). Three bands were seen corresponding to acidic subunit of amandin (40–42KDa), basic subunit of amandin (20– 22KDa), and Pru du 4 or profilin (14 KDa) (Figure 7). The migrated three bands correspond to 42, 22 and 14kDa. The same profile was obtained at the protein processed by heating, and those processed by enzymatic hydrolysis. No band was found when the protein treated by heating followed by enzymatic hydrolysis.
Figure 5. Graphical representation of Absorbance of IgG anti-AP boiled and roasted (n=11 tests). Absorbance represented percentage in relation to test values compared to data obtained in control (No treated AP). The control test was conducted by using native proteins.
Figure 6. Size-exclusion Chromatography of Almond Protein Variety Prunus dulcis.
Ouahidi et al. n Molecular characterization of Amandin
27 Figure 7. Electrophoresis profile of protein extracts of native almond (2); processed by heat (3); processed by heat and enzymatic hydrolysis (4); processed by enzymatic hydrolysis (5).
8. Sensitivity to Amandin Figure 8 shows the serum level of anti-Amandin IgE of 20 patients in different conditions. Native amandin or those which were processed by heat or pepsin digestion/heat were used to evaluate their detection by the human serum IgE. There was a decrease of the immunoreactivity when the proteins were treated at 100°C. This decrease was even more pronounced with additional treatment of pepsin.
Discussion Food allergies have significantly increased in the past few years, which reflects a major public health concern. The prevalence of food allergies is constantly rising. The aim of our work was to study the characteristics of allergenicity to the AP among the population of the Fez region, as well as the effects of physicochemical treatment on these allergens.
Our methodology was based on the evaluation of the human IgE binding to the native proteins or the ones subject to thermal or enzymatic treatment. The biologic test used to evaluate these immunological reactions was ELISA, based on a set of human sera. They reported that 2.2% of the students declared they have sensitivity to almond, which was higher than reported earlier in France (1.7%).[7] Another study suggested that the frequency of nuts, in episodes of food-induced anaphylaxis showed different values in Great Britain with 3.3%[8] and the USA with 5.6%.[10] A population of 252 patients was studied for the immunoreactivity against the AP. Among this population, 67% had a specific IgE level (against almond protein) higher than 50 IU/mL. Among all patients 10.4% had a rate between 20 and 80 IU/mL, 7.55% between 80 and 120 IU/mL and 5%
Figure 8. Serum level of specific IgE antiamandin native and the effect of heating and enzymatic hydrolysis on the recognition of processed AP by human IgE.
28 between 120 and 200 IU/mL. The average concentration was 42±2 IU/mL, and the minimum and maximum values ranged between 2.4 and 334.8 IU/mL. The IgE levels showed a strong sensitivity of the studied population to AP, which was explained by the daily consumption of almonds in Morocco. The obtained results with rabbit IgG and IgE showed a reduction of the antibody binding for the heat-treated proteins compared to the native ones. After a 120 min heat-treatment a 52% reduction of antiAP IgG was noticed. Human IgE levels were decreased 85% when AP was heated. Decreased allergenicity with heat was observed for several allergens of plant of animal origin, which are known as thermolabile. These foods lose their allergenicity as shown for white beans[18], peanut[17] and wheat flour[24,26], meats[27], egg white[20,28] and soy.[29] These findings could be explained by a fragmentation of a part of proteins as suggested by the protein band attenuation observed by electrophoresis. The greater decrease observed for IgE in comparison with IgG suggested that some antigens recognized by IgE in the studied population had conformationally unstable antigenic sites, where, in contrast, a majority of antigens recognized by rabbit IgG had stable epitopes. Another series of experiment were carried out pre-heated and/or enzymatically digested proteins. The enzymatic treatment was used to simulate the digestive enzymes on the food in the digestive tract, since all foods go through it before being absorbed. Generally, the enzymatic hydrolysis known as a process which reduces the allergenicity of a protein and allows obtaining protein hydrolysates used in the formulas called “hypoallergenic”. The experiments for the almond proteins hydrolyzed with pepsin showed that anti-AP IgG has decreased by 91%, Similarly, anti-AP IgE was reduced at a rate of 95%. These numbers were higher than those obtained by heating only, without hydrolysis. This indicated that the pre-heating may ameliorate the enzymatic action. Mondoulet et al.[30–32] showed that the allergens of nuts, milk and peanut were sensitive to the hydrolysis by the digestive enzymes, such as the pepsin for the gastric digestion and the trypsin and chymotrypsin for the duodenal digestion.
Turk J Immunol 2017; 5(1):20–30
Food processing can alter allergenicity of proteins, increasing or decreasing the potential to be recognized by immunoglobulin E (IgE).[33,34] Albillos et al. (2009) found that amandin formed aggregates after heating in PBS at temperatures exceeding 77°C. These aggregates might bind to the antibody differently, compared with the native amandin and therefore cause a decrease in immunoreactivity. Wigotzki et al. (2000)[35] investigated the stability of hazelnut protein extracts against various enzymes. They reported a decrease in the immunoreactivity of these proteins in different enzymatic environments. We can speculate that the majority of epitopes recognized by both IgG and IgE are thermolabile, thus more conformational than sequential. However, a part of resistant sites to heat denaturation proves the existence of sequential epitopes. Immunoreactivity of different industrial products was studied for the rabbit IgG. The immunoreactivity was evaluated for grilled and boiled food, and it was evaluated in two conditions: with or without enzymatic hydrolysis. In general, the IgG binding on these proteins decreases with hydrolysis time.[36] The boiled foods showed the lowest immunological reactivity while the grilled ones had a high reactivity, indicating the development of new allergenic epitopes by Maillard reaction. As for the roasted foods, Müller found a strongly reduced IgE-binding to proteins from roasted hazelnuts.[36] The obtained results for the native amandin proteins (a major almond allergen) revealed the existence of 2 bands (Pru du 6, 11S globulin) which migrated around 40 and 42 kDa marking (Acid polyeptidic alpha chain), as well as the basic beta chain at 20 and 22 kDa. These results were comparable with other studies, suggesting a major reactivity for these two bands.[25] The same electrophoretic profile was observed in various studies depicting these bands and their reactivity mainly with the human sera.[4,37] The same profile was obtained for the heat-treated proteins, and the ones having undergone the enzymatic hydrolysis. No band was revealed in the case of the protein extract treated with heat and followed by the enzymatic hydrolysis (combination of treatments). We can conclude that pre-heating releases the binding domains to the enzyme, which are originally unmasked. Sensitivity to amandin is a common problem around the world. Our studied population had also a similarity
Ouahidi et al. n Molecular characterization of Amandin
with the studied populations in the USA concerning the sensitivity to amandin.[4,15] As for the diminution of immunoreactivity of antibodies after the heating of the amandin, it was previously detected. This indicates that the antigenic epitopes of amandin detected by the human IgE are predominantly conformational and are modified, at least partially, by heating. CONFLICT OF INTEREST We attest that all Authors listed on the title page have contributed significantly to the work, have read the manuscript, attest to the validity and legitimacy of the data and its interpretation, and agree to its submission to this Journal. ACKNOWLEDGEMENTS This work was supported by grants of the Laboratory of Bioactive Molecules (LMBSF), Faculty of Sciences & Techniques from Fez. We would like to thank the hospital Ibn Elkhatib of Fez, the University Hospital Center, and the private medical laboratories in Fez for their help in collecting sera.
References 1. Sicherer SH, Sampson HA. 9. Food allergy. J Allergy Clin Immunol 2006;117:S470-5. doi: 10.1016/j.jaci.2005.05.048 2. Sampson HA, Mendelson L, Rosen JP. Fatal and near-fatal anaphylactic reactions to food in children and adolescents. N Engl J Med 1992;327:380–4. doi: 10.1056/NEJM199208063270603 3. Pumphrey RS, Stanworth SJ. The clinical spectrum of anaphylaxis in north-west England. Clin Exp Allergy 1996;26:1364–70. 4. Albillos SM, Menhart N, Fu TJ. Structural stability of Amandin, a major allergen from almond (Prunus dulcis), and its acidic and basic polypeptides. J Agric Food Chem 2009;57:4698–705. doi: 10.1021/jf803977z 5. Emmett SE, Angus FJ, Fry JS, Lee PN. Perceived prevalence of peanut allergy in Great Britain and its association with other atopic conditions and with peanut allergy in other household members. Allergy 1999;54:380–5(erratum 54:891). 6. Allergen Nomenclature Sub-Committee, International Union of Immunological Societies(2001)Allergen Nomenclature: List of allergens. http://www.allergen.org 7. Andre F, Andre C, Colin L, Cacaraci F, Cavagna S. Role of new allergens and of allergens consumption in the increased incidence of food sensitizations in France. Toxicology 1994;93:77–83. 8. Pumphrey RS, Stanworth SJ. The clinical spectrum of anaphylaxis in north-west England Clin Exp Allergy 1996;26:1364–70. 9. Novembre E, Cianferoni A, Bernardini R, Mugnaini L, Caffarelli C, Cavagna G, Giovane A, Vierucci A. Anaphylaxis in children: clinical and allergological features. Pediatrics 1998;101:E8. 10. Kemp SF, Lockey RF, Wolf BL, Lieberman P. Anaphylaxis. A review of 266 cases. Arch Intern Med 1995;155:1749–54. 11. Derbyshire E, Wright DJ, Boulter D. Legumin and vicilin, storage proteins of legume seeds. Phytochemistry 1976;15:3–24. doi: 10.1016/S0031-9422(00)89046-9 12. Sathe SK, Wolf WJ, Roux KH, Teuber SS, Venkatachalam M, Sze-Tao KW. Biochemical characterization ofamandin, the major storage protein in almond (Prunus dulcis L.). J Agric Food Chem 2002;50:4333–41.
29 13. Roux KH, Teuber SS, Robotham JM, Sathe SK. Detection and stability of the major almond allergen in foods. J Agric Food Chem 2001;49:2131–6. 14. Sathe SK, Teuber SS, Gradziel TM, Roux KH. Electrophoretic and immunological analyses of almond (Prunusdulcis l.) genotypes and hybrids. J Agric Food Chem 2001;49:2043–52. 15. Albillos SM, Jin TC, Howard A, Zhang YZ, Kothary MH, Fu TJ. Purification, crystallization and preliminary X-ray characterization of prunin-1, a major component of the almond (Prunus dulcis) allergen amandin. J Agric Food Chem 2008;56:5352–8. doi: 10.1021/jf800529k 16. Davis PJ, Smales CM, James DC. How can thermal processing modify the antigenicity of proteins? Allergy 2001;56 Suppl 67:56–60. 17. Ouahidi I, Aarab L, Dutau G. Influence des traitements thermiques et acides sur l’allergénicité des protéines d’arachide au niveau de la population de la région Fès-Meknès au Maroc. Rev Fr Allergol 2010;50:15–21. doi: 10.1016/j.reval.2009.08.008 18. Bousfiha A, Lotfi A. Effect of heat and enzymatic treatments on human IgE and rabbit IgG sensitivity to white bean allergens. Iran J Allergy Asthma Immunol 2013;12:304–11. 19. Ouahidi I. Etude des sensibilités allergiques à différents aliments au niveau de la population Fès-Meknès: Epidémiologie, stabilité des allergènes aux traitements industriels et mise au point de trousses analytique. Thèse Doctorat Universitaire. Université Sidi Mohamed Ben Abdellah, 2011. 20. Ouahidi I, El Youbi El Hamsas A, Aarab L. Modulation of egg white proteins allergenicity under physical and chemical treatments. Food and Agri Immuno 2011;22:57–68. doi: 10.1080/09540105.2010.526202 21. Bousfiha A, Aarab L. Sensibilité de la population des régions de Fès et Casablanca au Maroc à la viande de poulet et effet de la température. Immuno-analyse & Biologie Spécialisée 2012;27:112–6. doi: 10.1016/j.immbio.2012.02.005 22. Bousfiha A, Aarab L. Modulation of IgE immunoreactivity to broad bean proteins after food processing in a Moroccan population. Allergol Immunopathol (Madr) 2012;42:29–34. doi: 10.1016/j.aller.2012.06.004 23. Ouahidi I, Elhamsas Ael Y, Bouyahyaoui Y, Mernissi FZ, Aarab L. Characterization and stability of specific IgE to white egg’s, gliadin’s and peanut’s proteins among children. Iran J Allergy Asthma Immunol 2010;9:97–102. doi: 09.02/ijaai.97102 24. Ouahidi I, Barakat A, El Hamsas AEY, Aarab L. Variation de l’immunoréactivité des IgE et des IgG vis-à-vis des gliadines sous l’effet du pH et de la température. Immunoanalyse & Biologie Spécialisée 2011;26:68–75. doi: 10.1016/j.immbio.2010.10.005 25. L’Hocine L, Pitre M. Quantitative and qualitative optimization of allergen extraction from peanut and selected tree nuts. Part 2. Optimization of buffer and ionic strength using a full factorial experimental design. Food Chem 2016;194:820–7. doi: 10.1016/j.foodchem.2015.08.032 26. Varjonen E, Björksten F, Savolainen J. Stability of cereal allergens. Clin Exp Allergy 1996;26:436–43. 27. Fiocchi A, Restani P, Riva E, Mirri GP, Santini I, Bernardo L, Galli CL. Heat treatment modifies the allergenicity of beef and bovine serum albumin. Allergy 1998;53:798–802.
30 28. Anet J, Back JF, Baker RS, Barnett D, Burley RW, Howden ME. Allergens in the white and yolk of hen’s egg. A study of IgE binding by egg proteins. Int Arch Allergy Immunol 1985;77:364–71. 29. Besler M, Steinhart H, Paschke A. Stability of food allergens and allergenicity of processed foods. J Chromatogr B Biomed Sci Appl 2001;756:207–28. 30. Mondoulet L, Drumare MF, Leung SA, Paty E, Scheinmann P, Wal JM, et al. Influence des procédés thermiques sur l’allergénicité de l’arachide. Rev Fr Allergol Immunol Clin 2003;43:486–91. 31. Mondoulet L, Paty E, Drumare MF, et al. Influence of thermal processing on the allergenicity of peanut proteins. J Agric Food Chem 2005;53:4547–53. doi: 10.1021/jf050091p 32. Mondoulet L. Diversité de la réponse IgE dans l’allergie à l’arachide : caractérisation des allergènes et devenir de leur potentiel allergénique lors des traitements thermiques et des processus digestifs. Institut National des Sciences Appliquées de Toulouse 2005. 33. Cabanillas Martin B, Crespo JF, Burbano C, Rodríguez J. Systemic IgE-mediated reaction to a dietary slimming bar. Ann Allergy Asthma Immunol 2010;104:450.
Turk J Immunol 2017; 5(1):20–30
34. Cuadrado C, Cabanillas B, Pedrosa MM, Varela A, Guillamón E, Muzquiz M, Burbano C. Influence of thermal processing on IgE reactivity to lentil and chickpea proteins. Mol Nutr Food Res 2009;53:1462–8. doi: 10.1002/mnfr.200800485 35. Wigotzki M, Schubert S, Steinhart H, Paschke A. Effects of in vitro digestion on the IgE-binding activity of proteins from hazelnuts (Corylus avellana). Internet Symposium on Food Allergens 2000;2:1–8.
36. Müller U, Lüttkopf D, Hoffmann A, Petersen A, Becker WM, Schocker F, Niggemann B, Altmann F, Kolarich D, Haustein D, Vieths S. Allergens in raw and roasted hazelnuts (Corylus avellana) and their cross-reactivity to pollen. Eur Food Res Technol 2000;212:2–12. doi: 10.1007/s002170000245 37. Zhang Y, Zhang J, Sheng W, Wang S, Fu TJ. Effects of heat and high-pressure treatments on the solubility and immunoreactivity of almond proteins. Food Chem 2016;199:856–61. doi: 10.1016/j.foodchem.2015.12.063
Turk J Immunol 2017; 5(1):31
Erratum TJI Cilt 4, Suppl 1 (Ek 1) (2016), özel sayının 48. sayfasında P-0081 nolu bildiride yer alması gereken bilgi sehven atlanmıştır. Bu hatayı düzeltir, okurlarımızdan özür dileriz.
Türk İmmünoloji Derneği tarafından 27-30 Nisan 2016 tarihlerinde Belek Antalya’da düzenlenmiş olan “3rd International Molecular Immunology & Immunogenetics Congress (MIMIC-III)” kongresine kabul edilen Bildiri Özetleri’nin yer aldığı Turk J Immunol Cilt 4, Suppl 1 (2016), özel sayının sayfa 48’de özeti yayınlanan “[P-0081] The distribution of NK subsets in CVID and some primary immunodeficient patients” başlıklı çalışmamız TÜBİTAK Sağlık Bilimleri Araştırma Destek Grubunda (SBAG) 214S536 proje numarası ile desteklenmiştir.
[P-0081] The distribution of NK subsets in CVID and some primary immunodeficient patients” Suzan Çınar1, Metin Yusuf Gelmez1, Nilgün Akdeniz1, Gülce Özçit1, Ayça Kıykım2, Elif Aydıner2, Günnur Deniz1 Department of Immunology, Istanbul University, Institute of Experimental Medicine, Istanbul, Turkey 2Division of Pediatric Allergy and Immunology, Marmara University, Medical Faculty, Istanbul, Turkey 1
31
w w w. t u r k i s h i m m u n o l o g y. o r g